Unlock instant, AI-driven research and patent intelligence for your innovation.

Reconstructed mvip3Aa11 gene and application thereof

A technology of pet-vip3aa11 and gene, applied in application, genetic engineering, plant genetic improvement, etc., can solve problems such as abnormal processing of transcripts, reduced translation efficiency, and weak insect resistance

Inactive Publication Date: 2012-07-04
INST OF PLANT PROTECTION CHINESE ACAD OF AGRI SCI
View PDF2 Cites 8 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, the insect resistance of these early Bt transgenic plants is very weak, it is difficult to detect mRNA transcription, and the protein expression level is very low
There are many reasons for the low expression of Bt genes in plants: for example, 1. The wild Bt gene is rich in AZ sequences, and the mRNA expressed in plants is unstable; 2. There may be eukaryotic gene inclusion in the wild Bt gene cleavage sites and transcription termination signal sequences, resulting in incomplete transcripts or abnormal processing of transcripts; 3. Microbes and plants have great differences in the frequency of codon usage in translation, which reduces translation efficiency; 4. True The 5'-UTR sequence of nuclear genes is very different from that of prokaryotic genes, and the 3' end of eukaryotic genes needs to be tailed to identify the signal sequence

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Reconstructed mvip3Aa11 gene and application thereof
  • Reconstructed mvip3Aa11 gene and application thereof
  • Reconstructed mvip3Aa11 gene and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0054] Example 1: Design and synthesis of new vip3Aa11 and cry2Ab4 gene (DNA) sequences and their preparation methods.

[0055] (1) Find out the codons preferred by plants such as cotton, and replace the codons corresponding to vip3Aa11 and cry2Ab4 genes with the codons preferred by plant genes while keeping the amino acid composition of the original Vip3Aa11 and Cry2Ab4 insecticidal proteins unchanged, and initially obtain Modified DNA sequence.

[0056](2) Exclude AT-rich sequences and commonly used restriction endonuclease sites in the DNA sequence that cause instability of plant gene transcripts, and then correct and eliminate them by replacing codons.

[0057] (3) Using computer software (DNAman) to analyze and eliminate the existence of large inverted repeat sequences in the gene by replacing codons.

[0058] (4) Add the restriction endonuclease recognition site sequence required for further cloning at both ends of the sequence.

[0059] (5) Determine the coding sequen...

Embodiment 2

[0085] Example 2: Expression, purification and verification of insecticidal activity of optimized new genes mvip3Aa11 and mcry2Ab4 in Escherichia coli

[0086] 1) Expression and purification of Cry2Ab4:

[0087] The mcry2Ab4 gene sequence was analyzed, and a pair of primers were designed according to the cloning site of Escherichia coli T7 expression vector pET21b, and BamHI and EcoRI restriction sites were introduced into the two primers respectively. A primer pair (2abup: CGC GGATCCGATGAATAGTGTATTGAATAGC / 2abdown CCG GAATTC AAACTTTAATAAAGTGGTG) was used to amplify the mcry2Ab4 gene, and the template was pUCCRY2AB. Amplification was carried out according to the following parameters: pre-denaturation at 94°C for 3 min; denaturation at 94°C for 1 min; annealing at 53°C for 1 min; extension at 72°C for 3 min, 32 cycles; final extension at 72°C for 10 min. The polymerase is PFU polymerase.

[0088] The full-length cry2Ab4 gene was amplified, and the PCR product and vector pET-21...

Embodiment 3

[0091] Example 3: Vip3Aa11 and Cry2Ab4 protein insecticidal activity verification and synergistic analysis:

[0092] Vip3Aa11 and Cry2Ab4 proteins expressed and purified in Escherichia coli were tested for their individual insecticidal activity and 1:1 combination activity, and then calculated the synergistic coefficient of the two proteins. The results showed that the combined use of the two proteins and the single use had significant insecticidal effects on the sensitive strain 96S and the resistant strain BtR of cotton bollworm. In the results using mortality as the evaluation standard (Table 4, showing the results of the synergistic effect of the mortality assay method), the synergistic values ​​of the protein combination to the sensitive and resistant populations were 117.44% and 199.82, respectively, and the synergistic The effect is remarkable. And in the result (Table 5, has shown the result of measuring synergism by body weight suppression method) with body weight in...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to a reconstructed mvip3Aa11 gene and application thereof, belonging to the technical field of biological prevention and control. The code of the reconstructed mvip3Aa11 gene has the protein of the amino acid sequence shown in SEQ NO2, and the nucleotide sequence is shown in SEQ NO1. In the invention, by adjusting the nucleotide composition of the vip2Aa11 gene, the vip2Aa11 gene is close to the codon frequency of plant gene without changing the coded amino acid sequence, and the reconstructed gene combination is expressed in plant so as to obtain resistance against lepidoptera pests.

Description

[0001] This application is a divisional application with the patent application number "2009102420406" and the title of the invention is "Transformed Bt genes mvip3Aa11, mcry2Ab4, gene combination and application thereof". technical field [0002] The invention belongs to the technical field of biological control, and in particular relates to gene combinations for expressing highly toxic proteins to lepidopteran pests, artificially synthesized sequences and applications thereof. Background technique [0003] Insect pests are one of the important factors causing agricultural production loss. According to statistics, the direct economic loss caused by insect pests to agricultural production is as high as 15% every year. Chemical pesticides have made important contributions to pest control and stable agricultural production. With people's awareness of the environmental hazards of chemical pesticides and the increasing awareness of environmental protection, in order to achieve ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/32C07K14/325C12N15/63C12N1/21A01H5/00C12R1/07
Inventor 张杰郎志宏梁革梅宋福平束长龙黄大昉
Owner INST OF PLANT PROTECTION CHINESE ACAD OF AGRI SCI