Reconstructed mvip3Aa11 gene and application thereof
A technology of pet-vip3aa11 and gene, applied in application, genetic engineering, plant genetic improvement, etc., can solve problems such as abnormal processing of transcripts, reduced translation efficiency, and weak insect resistance
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0054] Example 1: Design and synthesis of new vip3Aa11 and cry2Ab4 gene (DNA) sequences and their preparation methods.
[0055] (1) Find out the codons preferred by plants such as cotton, and replace the codons corresponding to vip3Aa11 and cry2Ab4 genes with the codons preferred by plant genes while keeping the amino acid composition of the original Vip3Aa11 and Cry2Ab4 insecticidal proteins unchanged, and initially obtain Modified DNA sequence.
[0056](2) Exclude AT-rich sequences and commonly used restriction endonuclease sites in the DNA sequence that cause instability of plant gene transcripts, and then correct and eliminate them by replacing codons.
[0057] (3) Using computer software (DNAman) to analyze and eliminate the existence of large inverted repeat sequences in the gene by replacing codons.
[0058] (4) Add the restriction endonuclease recognition site sequence required for further cloning at both ends of the sequence.
[0059] (5) Determine the coding sequen...
Embodiment 2
[0085] Example 2: Expression, purification and verification of insecticidal activity of optimized new genes mvip3Aa11 and mcry2Ab4 in Escherichia coli
[0086] 1) Expression and purification of Cry2Ab4:
[0087] The mcry2Ab4 gene sequence was analyzed, and a pair of primers were designed according to the cloning site of Escherichia coli T7 expression vector pET21b, and BamHI and EcoRI restriction sites were introduced into the two primers respectively. A primer pair (2abup: CGC GGATCCGATGAATAGTGTATTGAATAGC / 2abdown CCG GAATTC AAACTTTAATAAAGTGGTG) was used to amplify the mcry2Ab4 gene, and the template was pUCCRY2AB. Amplification was carried out according to the following parameters: pre-denaturation at 94°C for 3 min; denaturation at 94°C for 1 min; annealing at 53°C for 1 min; extension at 72°C for 3 min, 32 cycles; final extension at 72°C for 10 min. The polymerase is PFU polymerase.
[0088] The full-length cry2Ab4 gene was amplified, and the PCR product and vector pET-21...
Embodiment 3
[0091] Example 3: Vip3Aa11 and Cry2Ab4 protein insecticidal activity verification and synergistic analysis:
[0092] Vip3Aa11 and Cry2Ab4 proteins expressed and purified in Escherichia coli were tested for their individual insecticidal activity and 1:1 combination activity, and then calculated the synergistic coefficient of the two proteins. The results showed that the combined use of the two proteins and the single use had significant insecticidal effects on the sensitive strain 96S and the resistant strain BtR of cotton bollworm. In the results using mortality as the evaluation standard (Table 4, showing the results of the synergistic effect of the mortality assay method), the synergistic values of the protein combination to the sensitive and resistant populations were 117.44% and 199.82, respectively, and the synergistic The effect is remarkable. And in the result (Table 5, has shown the result of measuring synergism by body weight suppression method) with body weight in...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More - R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com
