Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

D24 fiber protein modified conditionally replicating adenovirus carrier with exogenous gene by one-step method and application of carrier

A technology of fibrin and exogenous genes, applied in the fields of application, gene therapy, genetic engineering, etc., can solve the problems of time-consuming, complicated process, etc., and achieve the effect of improving the treatment effect

Inactive Publication Date: 2012-07-18
SHAANXI NORMAL UNIV
View PDF2 Cites 15 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, the process of constructing oncolytic adenoviral vectors carrying foreign genes is very complicated and time-consuming

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • D24 fiber protein modified conditionally replicating adenovirus carrier with exogenous gene by one-step method and application of carrier
  • D24 fiber protein modified conditionally replicating adenovirus carrier with exogenous gene by one-step method and application of carrier
  • D24 fiber protein modified conditionally replicating adenovirus carrier with exogenous gene by one-step method and application of carrier

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0045] This example gives the conditionally replicable adenoviral vector HB D24-5 / 11-TRAIL / eGFP modified by D24 fibrin carrying eGFP and TRAIL, as follows:

[0046] (1) The 24-base sequence deleted between 922bp and 947bp in the human adenovirus vector type 5 genome, the 24-base sequence of the deletion is: cttacctgccacgaggctggcttt.

[0047] (2) A modified fibrin 5 / 11 is inserted at 31042 bp in the human adenovirus vector type 5 genome, ie at the fibrin Tail. The inserted sequence is:

[0048] atgaagcgcgcaagaccgtctgaagataccttcaaccccgtgtatccatatgacacggaaaccggtcctccaactgtgccttttcttactcctccctttgtatcccccaatgggtttcaagagagtccccctggtcttactttaaaatgtttaaccccgctaacaaccacaggcgggtctctacagctaaaagtgggagggggacttacagtagatgacactgatgggaccttacaagaaaacataggtaccaccacaccacttgttaagactgggcactctataggtttatccctaggagccggattgggaacagatgaaaataaactttgtaccaaattgggaaaaggacttacattcaattcaaacaacatttgcattgatgacaatattaacaccctgtggacaggaattaaccccaccgaagccaactgtcaaatgatggactccagtgaatctaatgattgcaaattaattctaacactagttaaa...

Embodiment 2

[0085] The steps for constructing a conditionally replicable adenoviral vector modified with D24 fibrin expressing red fluorescent protein and TRAIL gene are as follows:

[0086] In Example 1, a shuttle vector carrying an exogenous gene was constructed, and the reporter gene eGFP was connected to the miniCMV-SV40 expression frame, and the green fluorescent protein eGFP in the PGK-SV40 expression frame was connected to the therapeutic gene TRAIL, which was replaced by red fluorescent protein. Other structures of the carrier are the same as in Example 1.

Embodiment 3

[0088] The steps for constructing a conditionally replicable adenoviral vector modified with D24 fibrin expressing luciferase and TRAIL genes are as follows:

[0089] In Example 1, a shuttle vector carrying an exogenous gene was constructed, and the reporter gene eGFP was connected in the miniCMV-SV40 expression frame, and the green fluorescent protein eGFP in the therapeutic gene TRAIL was connected in the PGK-SV40 expression frame and replaced with luciferase. Other structures of the carrier are the same as in Example 1.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a D24 fiber protein modified conditionally replicating adenovirus carrier with an exogenous gene by a one-step method and an application of the carrier. on the basis of an Ad56 D24 conditionally replicating adenovirus carrier, the construction efficiency of the carrier for inserting into the exogenous gene can be improved by two aspects: (1) a BamHi locus on an adenovirus gene group is mutated; and (2) BamHi and SfuI are introduced between fiber and E4 by a homologous recombination method so as to introduce the exogenous gene into the adenovirus gene group in one step by an enzyme digestion ligation method. The obtained D24 fiber protein modified conditionally replicating adenovirus carrier with an exogenous gene is subjected to the pesticide effect experiment to prove that the D24 fiber protein modified conditionally replicating adenovirus carrier with an exogenous gene can improve a treatment effect on turmor.

Description

technical field [0001] The invention belongs to the technical field of biological genes and relates to the construction and application of genes, in particular to the one-step construction of a D24 fibrin-modified conditional replication adenovirus vector carrying exogenous genes and its application. Background technique [0002] At present, it has been proved that the molecular and cellular pathological process of tumor formation is caused by gene mutation, so theoretically speaking, it is feasible to design gene therapy for different stages and characteristics of tumor pathology. Currently, gene therapy mainly uses viral vectors and non-viral vectors. Due to the low transfection efficiency of non-viral vectors, most current gene therapy is mediated by viral vectors. [0003] Adenovirus vectors have many advantages in the field of gene therapy, such as: infecting a wide range of cell types and high infection rate; stable physical and chemical properties, easy to prepare hi...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/861C12N15/66A61K48/00A61P35/00
Inventor 夏海滨李星
Owner SHAANXI NORMAL UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com