D24 fiber protein modified conditionally replicating adenovirus carrier with exogenous gene by one-step method and application of carrier
A technology of fibrin and exogenous genes, applied in the fields of application, gene therapy, genetic engineering, etc., can solve the problems of time-consuming, complicated process, etc., and achieve the effect of improving the treatment effect
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0045] This example gives the conditionally replicable adenoviral vector HB D24-5 / 11-TRAIL / eGFP modified by D24 fibrin carrying eGFP and TRAIL, as follows:
[0046] (1) The 24-base sequence deleted between 922bp and 947bp in the human adenovirus vector type 5 genome, the 24-base sequence of the deletion is: cttacctgccacgaggctggcttt.
[0047] (2) A modified fibrin 5 / 11 is inserted at 31042 bp in the human adenovirus vector type 5 genome, ie at the fibrin Tail. The inserted sequence is:
[0048] atgaagcgcgcaagaccgtctgaagataccttcaaccccgtgtatccatatgacacggaaaccggtcctccaactgtgccttttcttactcctccctttgtatcccccaatgggtttcaagagagtccccctggtcttactttaaaatgtttaaccccgctaacaaccacaggcgggtctctacagctaaaagtgggagggggacttacagtagatgacactgatgggaccttacaagaaaacataggtaccaccacaccacttgttaagactgggcactctataggtttatccctaggagccggattgggaacagatgaaaataaactttgtaccaaattgggaaaaggacttacattcaattcaaacaacatttgcattgatgacaatattaacaccctgtggacaggaattaaccccaccgaagccaactgtcaaatgatggactccagtgaatctaatgattgcaaattaattctaacactagttaaa...
Embodiment 2
[0085] The steps for constructing a conditionally replicable adenoviral vector modified with D24 fibrin expressing red fluorescent protein and TRAIL gene are as follows:
[0086] In Example 1, a shuttle vector carrying an exogenous gene was constructed, and the reporter gene eGFP was connected to the miniCMV-SV40 expression frame, and the green fluorescent protein eGFP in the PGK-SV40 expression frame was connected to the therapeutic gene TRAIL, which was replaced by red fluorescent protein. Other structures of the carrier are the same as in Example 1.
Embodiment 3
[0088] The steps for constructing a conditionally replicable adenoviral vector modified with D24 fibrin expressing luciferase and TRAIL genes are as follows:
[0089] In Example 1, a shuttle vector carrying an exogenous gene was constructed, and the reporter gene eGFP was connected in the miniCMV-SV40 expression frame, and the green fluorescent protein eGFP in the therapeutic gene TRAIL was connected in the PGK-SV40 expression frame and replaced with luciferase. Other structures of the carrier are the same as in Example 1.
PUM

Abstract
Description
Claims
Application Information

- R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com