Method for producing 3-hydroxypropionic acid and other products

A technology of hydroxypropionic acid and acrylic acid, applied in the directions of biochemical equipment and methods, introduction of foreign genetic material, microorganisms, etc. using carriers

Inactive Publication Date: 2012-09-26
OPX BIOTECH +1
View PDF54 Cites 15 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Unfortunately, previous attempts to achieve commercially viable titers using microorganisms to synthesize 3-HP showed that the microorganisms used were inhibited by 3-HP concentrations well below the measured commercially viable titers

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for producing 3-hydroxypropionic acid and other products
  • Method for producing 3-hydroxypropionic acid and other products
  • Method for producing 3-hydroxypropionic acid and other products

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0461] Example 1: Construction of a plasmid expressing malonyl-CoA reductase (mcr)

[0462] According to the service provided by the commercial DNA gene synthesis provider DNA2.0 (Menlo Park, CA USA), the nucleic acid sequence of the malonyl-CoA reductase gene from Chloroflexus aurantiacus was codon-optimized for E. coli. The gene sequence (SEQ ID NO: 803) integrates an EcoRI restriction site before its start codon and a HindIII restriction site afterwards. In addition, a ribosome binding site is preceded by the start codon. This gene construct was synthesized by DNA2.0 and provided in the pJ206 vector backbone (SEQ ID NO: 804). The plasmid DNA pJ206 containing the synthetic mcr gene was subjected to enzymatic restriction digestion using EcoRI and HindIII enzymes obtained from New England BioLabs (Ipswich, MA USA) according to the manufacturer's instructions. The digestion mixture was separated by agarose gel electrophoresis and the appropriate DNA fragments were recovered as d...

Embodiment 2

[0466] Example 2: Construction of a plasmid expressing transhydrogenase (pntAB)

[0467] The non-inducer-dependent E. coli promoter derived from the tpiA gene (P tpiA ) Fusion with the pyridine nucleotide transhydrogenase gene pntAB (SEQ ID NO: 779 and SEQ ID NO: 781) was produced by amplifying the tpiA promoter region and pntAB region from genomic E. coli K12 DNA using polymerase chain reaction. For the pntAB gene, the pntAB forward primer GGGAACCATGGCAATTGGCATACCAAG (SEQ ID NO: 807, note that all the primers disclosed herein are artificial sequences) and the pntAB reverse primer containing the NcoI site of the starting Met incorporated into the pntA protein sequence were used GGGTTACAGAGCTTTCAGGATTGCATCC (SEQ ID NO: 808) amplified this region. Similarly, the P tpiA The region was amplified using the forward primer GGGAACGGCGGGGAAAAACAAACGTT (SEQ ID NO: 809) and the reverse primer GGTCCATGGTAATTCTCCACGCTTATAAGC (SEQ ID NO: 810) containing the NcoI restriction site. The polyme...

Embodiment 3

[0471] Example 3: Construction of a plasmid expressing acetyl-CoA carboxylase (accABCD)

[0472] A plasmid carrying two operons that can express the components of the E. coli acetyl-CoA carboxyltransferase complex was constructed by a commercial DNA gene synthesis provider DNA2.0 (Menlo Park, CA USA). This construct integrates the DNA sequences of accA and accD genes under the control of an inducer-independent promoter derived from the E. coli tpiA gene, and under the control of an inducer-independent promoter derived from the E. coli rpiA gene The DNA sequences of accB and accC genes below. Each coding sequence has a ribosome binding sequence before it. The designed operon was provided in the pJ251 vector backbone and was named pJ251:26385 (SEQ ID NO:817).

[0473] The tpiA promoter of the pJ251:26385 plasmid was modified to provide higher expression. The modification was introduced by amplifying the plasmid using the forward primer GCGGGGCAGGAGGAAAAACATG (SEQ ID NO: 818) and t...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
concentrationaaaaaaaaaa
diameteraaaaaaaaaa
concentrationaaaaaaaaaa
Login to View More

Abstract

This invention relates to metabolically engineered microorganism strains, such as bacterial strains, in which there is an increased utilization of malonyl-CoA for production of a chemical product, which includes 3- hydroxypropionic acid.

Description

[0001] Cross references to related applications [0002] This application requires U.S. Provisional Application No. 61 / 246,141 filed on September 27, 2009, U.S. Provisional Application No. 61 / 298,844 filed on January 27, 2010, and U.S. Provisional Application No. 61 / 321,480 filed on April 6, 2010 Priority for US provisional applications. The entire content of each application is hereby incorporated by reference. Technical field [0003] The present invention relates to metabolically engineered microorganisms, such as bacterial strains, which have improved utilization of malonyl-CoA for the preparation of chemical products, which may include the chemical 3-hydroxypropionic acid (3-HP ) And products made from 3-HP. The metabolically engineered microorganism can be adapted to exhibit increased tolerance to 3-HP. In addition, genetic modification is performed to provide one or more 3-HP biosynthetic pathways, such as one or more genetically modified microorganisms that include a com...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12N15/74C12P7/18C12N1/20
CPCC12M47/12C12P7/40A61L15/24C12N15/63C12P7/42C12P7/52C12N9/0008C12N9/12C12N9/16C12Y102/04001C12Y207/00C12Y301/02Y02E50/10C08L33/08C12N1/00C12N15/52C12P1/00C12P7/62Y02P20/52C12P11/00
InventorM·D·林奇R·T·吉尔T·瓦内克-利普斯科布
OwnerOPX BIOTECH