Method for detecting dynamic changes of specific thermophilic microbial community of Pu-erh tea during pile fermentation process
A technology of stacking fermentation and dynamic change, applied in the field of microbial detection, can solve the problem of difficult to truly interpret the fermentation mechanism of Pu'er tea stacking, and achieve the effects of authentic experimental results, reduced workload, and high quality.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0046] Example 1: Detecting the Dynamic Changes of Mesophilic and Hyperthermic Actinomycetes During Pu-erh Tea Stack Fermentation
[0047]Mesophilic hyperthermic actinomycetes ( Thermoactinomyces thalpophilus ) as an experimental strain to verify the feasibility of the method of the present invention.
[0048] (1) Referring to literature reports, search for the corresponding 16S rDNA sequence of mesophilic hyperthermic actinomycetes in NCBI, perform sequence comparison analysis with clustalx software and Boxshade, finally determine its specific fragment and position, and design specific primers . The primers for mesophilic thermoactinomycetes are 5' GCTGGGTTGTAAAACTCTGT 3' and 5' CTTTCTCCTGAAGTACCGTC 3';
[0049] (2) Inoculate mesophilic and hyperthermic actinomycetes in beef extract-peptone liquid medium, culture with shaking at 50°C for 24 hours, centrifuge the cultured bacteria liquid to obtain bacterial cell precipitation; add the bacterial cells to sterile water, stir ...
Embodiment 2
[0059] Example 2: Detecting dynamic changes of thermophilic cotton wool fungus during the pile fermentation of Pu'er tea
[0060] Thermophilic cotton wool fungus ( Thermomyces lanuginosus ) as an experimental strain to verify the feasibility of the method of the present invention.
[0061] (1) Referring to literature reports, search for the corresponding 18S rDNA sequence of Cotton woolensis thermophiles in NCBI, and perform sequence comparison analysis with clustalx software and Boxshade, finally determine its specific fragment and position, and design specific primers, The primers of Cotton woolensis are 5' GCTCAAGCCGATGGAAGT 3' and 5' CCAGCACGACAGGGTTTA 3';
[0062] (2) Inoculate the thermophilic cotton hairy fungus in the potato liquid medium and shake and culture at 55°C for 24 hours, centrifuge the cultivated bacterial liquid to obtain the bacterial cell precipitation; add the bacterial cell to the sterile water, stir evenly, and then mix with raw Mix the tea evenly (...
Embodiment 3
[0071] Example 3: Detecting the dynamic changes of specific high-temperature bacteria during the fermentation process of Pu-erh tea
[0072] The Pu-erh tea is fermented directly without adding strains, and the dynamic changes of the high-temperature bacteria in the fermented tea are detected to verify the advantages of the method of the present invention.
[0073] (1) Sequence alignment and primer design
[0074] Referring to relevant literature reports, the 18S rDNA sequence of the thermophilic cottonwool and the 16S rDNA sequence of the mesophilic actinomycetes were searched in NCBI, and the sequence comparison analysis was carried out through the clustalx software and Boxshade, and finally the specific fragment and its position were determined. And design specific primers, the primers of thermophilic cotton hairy bacteria are 5' GCTCAAGCCGATGGAAGT 3' and 5' CCAGCACGACAGGGTTTA 3';
[0075] (2) Add an appropriate amount of sterile water, mix it with raw tea evenly (the amoun...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More - R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com
