Check patentability & draft patents in minutes with Patsnap Eureka AI!

Kit for warfarin personalized medication related gene SNP locus detection and PCR amplification method using same

A kit and gene technology, applied in the field of kits for detection of SNP sites of genes related to warfarin individualized medication and its PCR amplification, can solve the problems of low specificity, high price, low throughput, etc. , achieve high specificity, save capital, improve PCR efficiency and sensitivity

Inactive Publication Date: 2012-10-10
SUZHOU UNIV +1
View PDF2 Cites 6 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

The invention provides a mononuclear test for detecting vitamin K epoxide reductase complex 1 gene VKORC1 (-1639G / A) and cytochrome P450 enzyme 2C9 gene CYP2C9 (1075A / C), which affect clinical warfarin individualized dosage. A kit for nucleotide polymorphism (SNP) and a PCR amplification method thereof, the purpose is to solve the problem of high price, high cost and Low efficiency, low throughput and low specificity

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Kit for warfarin personalized medication related gene SNP locus detection and PCR amplification method using same
  • Kit for warfarin personalized medication related gene SNP locus detection and PCR amplification method using same
  • Kit for warfarin personalized medication related gene SNP locus detection and PCR amplification method using same

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0043] Embodiment 1: A kit for detecting single nucleotide polymorphism sites in genes associated with warfarin individualized medication comprising: 10×PCR Buffer, dNTP (2.5mM), Pfu DNA polymerase (2.5U / μl) and primers (10 mM each).

[0044] The base sequence of the primers for detecting the SNP site of the gene VKORC1 (-1639G / A) is as follows:

[0045] Forward primer: CCTGAAAAACAACCATTGGTCG (VKORC1-1639Gss);

[0046] CCTGAAAAACAACCATTGGTCA (VKORC1-1639Ass);

[0047] Reverse primer: AGTTTGGACTACAGGTGCCTG (VKORC1-1639R).

[0048] The base sequence of the primers for detecting the SNP site of gene CYP2C9(1075A / C) is as follows (5'→3'):

[0049] Forward primer: TGCACGAGGTCCAGAGATACAT (CYP2C91075Ass);

[0050] TGCACGAGGTCCAGAGATACCT(CYP2C91075Css);

[0051] Reverse primer: ACTGGAAACAAGAGAAAGTCCA (CYP2C91075R).

[0052] The -1, -2, -3 bases at the 3' end of the four forward primers were modified by phosphorothioation.

Embodiment 2

[0053] Example 2: A PCR amplification method used in a kit for detecting single nucleotide polymorphism sites of warfarin individualized drug-related genes

[0054] Include the following steps:

[0055] Step 1: Prepare DNA

[0056] (1) A blood sample is drawn from patient A.

[0057] (2) To obtain DNA from blood samples, we used the UNIQ-10 kit produced by Shanghai Bioengineering Technology Co., Ltd. for extraction.

[0058] Procedure for obtaining DNA from patient A's blood sample:

[0059] a. Take 500 ul blood samples that have been added with ACD (O.48% Citric Acid (citric acid); 1.32% Sodium Citrate (sodium citrate); 1.47% Glucose (glucose)) anticoagulant.

[0060] b. Add 1ml sterile water to 500ul blood sample, centrifuge at 5000 rpm for two minutes to remove supernatant, and suspend white blood cells with 200ul TE.

[0061] c. Add 200ul Digestion Buffer to the 200ul sample prepared in step b and mix well, then add 20ul Proteinase K (10mg / ml), mix well, and store at 5...

Embodiment 3

[0083] Example 3: A PCR amplification method used in a kit for detecting single nucleotide polymorphism sites of warfarin individualized drug-related genes

[0084] A blood sample was drawn from Patient B. Other experimental conditions are the same as in Example 2.

[0085] The result is: the gel electrophoresis obtained by using the primers to detect the SNP site of the gene VKORC1 (-1639G / A) is as attached figure 1 As shown in the middle of , there are products in both Ass and Gss lanes, indicating that the patient is heterozygous for the VKORC1(-1639A / G) mutation, and the patient is more sensitive to warfarin. The patient should appropriately reduce the dose of warfarin. The results can be attached by DNA sequencing image 3 Confirmed (sequencing with reverse primer).

[0086] The gel electrophoresis obtained by using primers to detect the SNP site of the gene CYP2C9 (1075A / C) is shown in the attached Figure 5 As shown in the middle of , there is only product in the As...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

A kit for warfarin personalized medication related gene SNP locus detection and a PCR amplification method using same. The kit includes two forward primers and one reverse primer for detecting gene VKORC1 (-1639G / A) SNP locus and / or two forward primers and one reverse primer for detecting gene CYP2C9 (1075A / C) SNP locus. The kit provided by the invention can realize VKORC1 (-1639G / A) and CYP2C9 (1075A / C) SNP locus detection with high efficiency and high throughput, so as to achieve warfarin dose quantification control, and even play a certain role for prevention of thrombotic disease, selection of anticoagulant drug, research and development of the novel anticoagulant drug, and prognosis of thrombotic disease.

Description

[0001] This application is filed on July 23, 2010, and the application number is 201010234597.8, and the name is "a kit for detecting SNP sites of genes related to warfarin individualized drug use and its PCR amplification method". case application. technical field [0002] The present invention relates to a kit for detecting SNP sites of genes related to warfarin individualized medication and a PCR amplification method thereof, in particular to a vitamin K epoxide reductase compound for detecting clinical warfarin medication doses The kit and the PCR amplification method of single nucleotide polymorphism (SNP) of object 1 gene VKORC1 (-1639G / A) and cytochrome P450 enzyme 2C9 gene CYP2C9 (1075A / C) belong to the clinical practice in the field of biomedicine Detection Technology. Background technique [0003] Warfarin is a dicoumarin derivative oral anticoagulant widely used clinically. It produces an anticoagulant effect by interfering with the conversion cycle between epoxi...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12Q1/68
Inventor 秦正红王进缪丽燕刘二平
Owner SUZHOU UNIV
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More