Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Plant stress tolerance related protein TaMYB19, and coding gene and application thereof

A plant stress tolerance and coding technology, which is applied in the direction of plant gene improvement, botanical equipment and methods, applications, etc., can solve the problems of complex plant stress resistance mechanism, achieve broad application and market prospects, and improve the effect of stress tolerance

Active Publication Date: 2012-10-17
INST OF CROP SCI CHINESE ACAD OF AGRI SCI
View PDF2 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0004] The mechanism of plant resistance to stress is very complex. Although traditional breeding methods have some effect on improving the stress resistance of crops, they are still far from the desired goal.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Plant stress tolerance related protein TaMYB19, and coding gene and application thereof
  • Plant stress tolerance related protein TaMYB19, and coding gene and application thereof
  • Plant stress tolerance related protein TaMYB19, and coding gene and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0041] Example 1. Discovery of TaMYB19 protein and its coding gene

[0042] In order to study the function of wheat MYB gene in plant stress resistance, 60 genes encoding wheat MYB protein were screened from the 30,000 non-redundant full-length wheat cDNA sequences sequenced in the laboratory through bioinformatics methods. By semi-quantitative PCR, the expression patterns of the 60 wheat MYB genes under stress conditions were studied, and the genes induced by stress were screened out.

[0043] The protein shown in sequence 1 of the sequence listing is named TaMYB19 protein, which consists of 247 amino acid residues. The gene encoding TaMYB19 protein is named TaMYB19 gene, and its open reading frame is shown in sequence 2 from the 5'end of nucleotide 58 to 798 (741 bp) in the sequence listing.

Embodiment 2

[0044] Example 2. Expression pattern of TaMYB19 gene under stress conditions

[0045] Two-leaf and one-heart stage Chinese spring wheat was subjected to low temperature stress and abscisic acid stress. Chadian red wheat with two leaves and one heart stage was treated with salt stress. Hanxuan No. 10 wheat with two leaves and one heart stage was subjected to drought stress.

[0046] Salt stress treatment: treatment with 250mM NaCl aqueous solution;

[0047] Drought stress treatment: treatment with 16.1% PEG aqueous solution;

[0048] Abscisic acid stress treatment: treated with 200uM ABA aqueous solution;

[0049] Low temperature stress treatment: treatment at 4℃.

[0050] The leaves were taken before treatment (0h), 1 hour after treatment, 3 hours after treatment, 7 hours after treatment, 12 hours after treatment and 24 hours after treatment; the total RNA of the leaves was extracted and the expression of TaMYB19 gene was detected by RT-PCR The target fragment of RT-PCR is 324bp, and ...

Embodiment 3

[0054] Example 3. Obtainment of transgenic plants and identification of stress tolerance

[0055] 1. Using Gateway technology to construct an overexpression vector

[0056] 1. AttB primer design

[0057] Primer Primer5.0 software was used to design primers to amplify the coding region of TaMYB19 gene. According to the requirements of Gateway technology to construct expression vector, attB1 and attB2 recombination sites were added to the 5'ends of upstream primer (F1) and downstream primer (R1), respectively. The designed primer sequence is as follows:

[0058] F1: 5’- GGGGACAAGTTTGTACAAAAAAGCAGGCT CGATGGGGAGGTCGCCGTG-3’;

[0059] R1: 5’- GGGGACCACTTTGTACAAGAAAGCTGGGT CGTCTCATATGTACTGGCCTTCC-3’.

[0060] In the upstream primer, the attB1 recombination site is underlined. In the downstream primer, the attB2 recombination site is underlined.

[0061] 2. Extract total RNA from Chinese spring wheat and reverse transcribed into cDNA.

[0062] 3. Using the cDNA of step 2 as a template, use t...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a plant stress tolerance related protein TaMYB19, and a coding gene and application thereof. The protein is the following (a) or (b): (a) a protein formed by amino acid sequences shown in Sequence 1 in a sequence table; and (b) a protein which is formed by the substitution and / or deletion and / or addition of one or more amino acid residues in the amino acid sequences in Sequence 1, is related to plant stress tolerance and is derived from Sequence 1. The method has great theoretical and practical significance in study of plant stress tolerance molecule mechanisms, selection of plant stress tolerance varieties and plant stress tolerance molecule breeding, and provides an economical, quick and effective approach for improving the plant stress tolerance. The protein has extensive application and market prospects in the agriculture field.

Description

Technical field [0001] The invention relates to a plant stress tolerance related protein TaMYB19 and its coding gene and application. Background technique [0002] Water shortage and soil salinization are serious facts facing global agricultural production. Due to frequent droughts, the average annual drought-affected area in my country is 327 million mu. With the global warming, the drought will become more and more serious. The area of ​​farmland threatened by drought may exceed 700 million mu. According to estimates, abiotic stresses such as drought, low temperature, and salinity have an impact on crop yields up to 40%. Major grain production areas in northern my country reduce production by 70-80 billion kilograms each year due to water shortages; seasonal droughts also occur in the south, where rainfall is abundant. Frequent occurrences, such as Guangdong’s annual drought area exceeding 7.5 million mu; Sichuan Province’s drought-affected area of ​​crops reached 21 million mu...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C07K14/415C12N15/29C12N15/63C12N5/10C12N1/21C12N15/82A01H5/00
Inventor 孔秀英张立超赵光耀贾继增刘旭
Owner INST OF CROP SCI CHINESE ACAD OF AGRI SCI
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com