Plant stress tolerance related protein TaMYB19, and coding gene and application thereof
A plant stress tolerance and coding technology, which is applied in the direction of plant gene improvement, botanical equipment and methods, applications, etc., can solve the problems of complex plant stress resistance mechanism, achieve broad application and market prospects, and improve the effect of stress tolerance
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0041] Example 1. Discovery of TaMYB19 protein and its coding gene
[0042] In order to study the function of wheat MYB gene in plant stress resistance, 60 genes encoding wheat MYB protein were screened from the 30,000 non-redundant full-length wheat cDNA sequences sequenced in the laboratory through bioinformatics methods. By semi-quantitative PCR, the expression patterns of the 60 wheat MYB genes under stress conditions were studied, and the genes induced by stress were screened out.
[0043] The protein shown in sequence 1 of the sequence listing is named TaMYB19 protein, which consists of 247 amino acid residues. The gene encoding TaMYB19 protein is named TaMYB19 gene, and its open reading frame is shown in sequence 2 from the 5'end of nucleotide 58 to 798 (741 bp) in the sequence listing.
Embodiment 2
[0044] Example 2. Expression pattern of TaMYB19 gene under stress conditions
[0045] Two-leaf and one-heart stage Chinese spring wheat was subjected to low temperature stress and abscisic acid stress. Chadian red wheat with two leaves and one heart stage was treated with salt stress. Hanxuan No. 10 wheat with two leaves and one heart stage was subjected to drought stress.
[0046] Salt stress treatment: treatment with 250mM NaCl aqueous solution;
[0047] Drought stress treatment: treatment with 16.1% PEG aqueous solution;
[0048] Abscisic acid stress treatment: treated with 200uM ABA aqueous solution;
[0049] Low temperature stress treatment: treatment at 4℃.
[0050] The leaves were taken before treatment (0h), 1 hour after treatment, 3 hours after treatment, 7 hours after treatment, 12 hours after treatment and 24 hours after treatment; the total RNA of the leaves was extracted and the expression of TaMYB19 gene was detected by RT-PCR The target fragment of RT-PCR is 324bp, and ...
Embodiment 3
[0054] Example 3. Obtainment of transgenic plants and identification of stress tolerance
[0055] 1. Using Gateway technology to construct an overexpression vector
[0056] 1. AttB primer design
[0057] Primer Primer5.0 software was used to design primers to amplify the coding region of TaMYB19 gene. According to the requirements of Gateway technology to construct expression vector, attB1 and attB2 recombination sites were added to the 5'ends of upstream primer (F1) and downstream primer (R1), respectively. The designed primer sequence is as follows:
[0058] F1: 5’- GGGGACAAGTTTGTACAAAAAAGCAGGCT CGATGGGGAGGTCGCCGTG-3’;
[0059] R1: 5’- GGGGACCACTTTGTACAAGAAAGCTGGGT CGTCTCATATGTACTGGCCTTCC-3’.
[0060] In the upstream primer, the attB1 recombination site is underlined. In the downstream primer, the attB2 recombination site is underlined.
[0061] 2. Extract total RNA from Chinese spring wheat and reverse transcribed into cDNA.
[0062] 3. Using the cDNA of step 2 as a template, use t...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More - R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com
