MiRNA in-situ hybridization probe, its detection kit and its application

A detection kit and in situ hybridization technology, applied in DNA/RNA fragments, recombinant DNA technology, microbial measurement/inspection, etc., can solve the problem of small Tm value, expensive price, and small Tm value cannot meet in situ hybridization And other problems, to achieve good specificity, cheap effect

Active Publication Date: 2012-10-17
GUANGZHOU EXONS BIOLOGICAL TECH
View PDF3 Cites 8 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

For miRNA, because the fragment length of miRNA is in the range of 18-22nt, which is relatively small, and the small Tm value cannot meet the needs of in situ hybridization, the above methods cannot solve these problems well
At present, in order to solve the small Tm value, a company in Denmark produces probes for detecting miRNA. Their probes are linked with 2'oxygen 4' carbon methylene groups on the five-carbon ring of the base, and then artificially synthesized. This method is effective Increased Tm value, but its price is expensive

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • MiRNA in-situ hybridization probe, its detection kit and its application
  • MiRNA in-situ hybridization probe, its detection kit and its application
  • MiRNA in-situ hybridization probe, its detection kit and its application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0028] Embodiment 1: the test kit of a preferred embodiment of the present invention

[0029] The kit in this example includes miR146-5p hybridization probe, control probe, prehybridization solution, blocking solution and markers.

[0030] The sequence of the miR146-5p hybridization probe is 5'-3': AGCCTATGGAATTCAGTTCTCA, in which the 3rd, 6th, 15th, and 20th base carbon atoms in the second position of the five-carbon ring are modified with fluorine atoms, and the 5' and 3' ends are modified Digoxin. The sequence of the control probe is 5'-3': AGTCTATGGTATTCAGTACTCA, and its 5' and 3' ends are also modified with digoxin. 20ml of prehybridization solution contains 4ml of 20×SSC, 4g of dextran sulfate, 10ml of deionized formamide, 0.5ml of Poly A (10mg / ml), 0.5ml of protidine ssDNA (10mg / ml), tRNA (10mg / ml) 0.5ml, 1M dithiothreitol (DTT) 2ml, 50*Denhardt's 0.2ml; the blocking solution is: add 0.1% Triton-X100, 3% normal goat serum, 3% BSA to PBS; the marker Fluorescent substr...

Embodiment 2

[0031] Embodiment 2: the test kit of another preferred embodiment of the present invention

[0032]The kit in this example includes hybridization probe miR375, control probe, prehybridization solution, blocking solution and markers. The sequence of the miR375 hybridization probe is 5'-3': TCACGCGAGCCGAACGAACAAA, in which the 3rd, 8th, 13th, and 21st bases of the five-carbon ring are modified with fluorine atoms at the second carbon atom, and the 5' and 3' ends are highly modified pungent. The sequence of the control probe is 5'-3': AGTCTATGGTATTCAGTACTCA. 20ml of prehybridization solution contains 4ml of 20×SSC, 4g of dextran sulfate, 10ml of deionized formamide, 0.5ml of Poly A (10mg / ml), 0.5ml of protidine ssDNA (10mg / ml), tRNA (10mg / ml) 0.5ml, 1M dithiothreitol (DTT) 2ml, 50*Denhardt's 0.2ml; the blocking solution is: add 0.1% Triton-X100, 3% normal goat serum, 3% BSA to PBS; the marker Fluorescent substrate for alkaline phosphatase.

Embodiment 3

[0033] Example 3: Verify the reliability of the probes in the kit of Example 1 of the present invention in non-small cell lung cancer cell lines and lung cancer tissues

[0034] (1) Materials and methods

[0035] Cell culture and tissue processing:

[0036] Non-small cell lung cancer cell lines ACC212102 and SCC211441 were cultured in DMEM containing 10% Tai bovine serum (containing L-glutamic acid). Cells were cultured at 37°C in 5% CO2, placed on glass coverslips for culture, and when the cell confluence reached 70%-80%, they were immediately fixed with formalin for 2 hours, and then ISH was performed.

[0037] Lung cancer tissues and normal tissues were embedded in conventional paraffin, deparaffinized and soaked in 0.2M HCl solution for 20 minutes, digested with 0.1% PBST, washed slides with RNase-free PBS for 2 minutes, air-dried, and then hybridized .

[0038] ISH probe:

[0039] miR146-5p probe sequence 5'-3': AGCCTATGGAATTCAGTTCTCA, 5' and 3' modified digoxin, in w...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides an miRNA in-situ hybridization probe, its detection kit and its application. A fluorine atom is modified by a 2-carbon atom of the base five-carbon ring of the hybridization probe. The preferable sequence of the probe is represented by SEQ ID NO:1, wherein fluorine atoms are modified by 2-carbon atoms of third, sixth, fifteenth and twentieth base five-carbon rings. The other preferable sequence of the probe is represented by SEQ ID NO:2, wherein the fluorine atoms are modified by 2-carbon atoms of third, eighth, thirteenth and twenty-first base five-carbon rings. Digoxin is modified by 5' and 3' terminals of the probe. The invention also provides an in-situ hybridization detection kit of the hybridization probe. The probe of the invention can be applied to the preparation of miRNA in-situ hybridization detection kits for lung cancer cell lines or lung cancer tissues, and the preparation of miRNA in-situ hybridization detection kits for esophageal cancer cell lines or esophageal cancer tissues. The kit of the invention has the advantages of low price and good specificity.

Description

technical field [0001] The invention relates to the field of molecular detection, in particular to an in situ hybridization probe of miRNA, a detection kit and application thereof. Background technique [0002] In situ hybridization technology is based on the principle of base complementarity of nucleic acid molecules, combining labeled DNA or RNA probes with denatured single-stranded DNA fragments or specific nucleotide sequences on tissues and cells under suitable conditions to form specific The position of the nucleic acid to be tested on the chromosome, tissue or cell is displayed through corresponding detection means. In situ hybridization was the first successful hybridization of Xenopus laevis nuclei by Gall and Parue (1969) using labeled rDNA probes. With the improvement of plant chromosome preparation technology, Rayburn (1985) was the first to apply the non-radioactive detection system to plant chromosome in situ hybridization. At present, this technology has bee...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12Q1/68C12N15/11
Inventor李江超关新元李焱
OwnerGUANGZHOU EXONS BIOLOGICAL TECH