Escherichia coli engineering strain having high phenethyl alcohol yield and application thereof

An engineering strain, Escherichia coli technology, applied in the field of metabolic engineering, can solve the problem of low synthesis or transformation ability, and achieve the effect of promoting production

Inactive Publication Date: 2013-01-02
JIANGNAN UNIV
View PDF0 Cites 15 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0013] Many fungi also have the ability to de novo synthesize or transform L-phenylalanine into β-phenylethanol, such as Phellinus igniarius, Phellinus laevigatus, Phellinus laevigatus tremulae), Ischnoderma benzoinum, Geotrichum penicillatum, Hericium erinaceus, Nigroporus durus and Aspergillus niger, etc., but the ability to synthesize or transform relatively low

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Escherichia coli engineering strain having high phenethyl alcohol yield and application thereof
  • Escherichia coli engineering strain having high phenethyl alcohol yield and application thereof
  • Escherichia coli engineering strain having high phenethyl alcohol yield and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0051] Construction and identification of embodiment 1 recombinant plasmid

[0052] The genomes of Pichia pastoris GS115 and Saccharomyces cerevisiae S288c were used as templates to obtain kdc and adh1 respectively,

[0053] The primers are as follows (the framed part is RBS, the underlined part is the primer restriction site)

[0054] kdc F:TCC CCCGGG ATGGCCCCAGTTCCAGATATAGCA

[0055] R:C GAGCTC TTAACCTACGATTTTGGCTTTGTTCTTG

[0056] adh1 F:AAAA CTGCAGGTAA ATGTCTATCCCCAGAAACTCAAAAAAGGTGT

[0057] R::CGC GGATCC GAATTTTCGTTTTAAAACCTAAGAGTCACTTTA

[0058] The reaction conditions are: 94°C for 5min; then 94°C for 30s, 62°C(adh1) / 63°C(kdc) for 30s, 72°C for 70s(adh1) / 108s(kdc) (30 cycles); 72°C for 10min for PCR The reaction was verified by 0.8% agarose gel electrophoresis and the PCR amplification product was recovered. As a result, the adh1 / kdc gene fragment ( figure 1 (a) - lane 2, figure 1 (b) - lane 2). The adh1 / kdc gene digested and purified with restrictio...

Embodiment 2

[0059] Example 2 The effect of co-expressing ADH1 and KDC enzymes on recombinant Escherichia coli phenylethanol fermentation

[0060] Different recombinant bacteria Escherichia coli were compared with the starting bacteria for fermentation experiments. Recombinant bacteria E.coli pAP-B03 / pCL-adh1-kdc were used for fermentation experiments, and the production of phenylalanine and β-phenylethanol was determined as follows: Figure 4 Shown: β-phenylethanol can be produced by both single and co-expression of phenylpyruvate decarboxylase (KDC) and alcohol dehydrogenase (ADH1), and the expression of β-phenylethanol under the condition of simultaneous expression of two enzyme genes The yield is the highest, the highest can reach 130mg / L, and the yield of phenylethyl alcohol cannot be detected by the starting bacteria E.coli pAP-B03 ( Figure 4 ).

[0061]

[0062]

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses an Escherichia coli engineering strain having high phenethyl alcohol yield and application thereof. An Escherichia coli gene engineering bacterium capable of substantially accumulating phenylalanine (L-Phe) is used as an original strain (the fermentation level of the shake flask fermented phenylalanine can be up to 6.0g / L); phenylpyruvic acid decarboxylase (KDC) and alcohol dehydrogenase (ADH1) are subjected to independent expression and appropriate gene combination to co-express two key enzyme genes so as to construct a recombinant strain; the recombinant strain capable of co-expressing phenylpyruvic acid decarboxylase and alcohol dehydrogenase can produce 130mg / L of beta-phenethyl alcohol, and the phenylalanine yield is 5.0g / L; and the accumulation of phenethyl alcohol can not be detected in the whole fermentation process of the Escherichia coli having high L-Phe yield of the original strain used as a control strain. The invention provides a method for enabling Escherichia coli to directly produce phenethyl alcohol through the fermentation of glucose used as a unique carbon source by means of a metabolic engineering means by using enzyme genes which can realize over-expression and are derived from anabolic pathways of different hosts.

Description

technical field [0001] The present invention relates to an engineering strain of Escherichia coli with high production of phenylalanine and its application, especially a recombinant Escherichia coli with high production of phenylalanine overexpressing phenylpyruvate decarboxylase (KDC) and alcohol dehydrogenase (ADH1) The invention relates to an engineering strain of Escherichia coli, which belongs to the field of metabolic engineering. Background technique [0002] β-phenylethanol (β-Phenylethanol), also known as 2-phenylethanol, β-phenylethanol, phenylethanol, chemical name is β-phenylethanol (2-phenylethyl alcohol, referred to as PEA), molecular formula is C8H10O, molecular weight is 122.16. [0003] β-phenylethanol is a kind of aromatic alcohol with elegant and delicate rose fragrance, which naturally exists in the essential oils of many flowers and plants, such as rose, hyacinth, jasmine, narcissus, lily, etc. Other products containing natural β-phenylethanol are Some...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12N1/21C12N15/70C12P7/22C12R1/19C12R1/84C12R1/865
Inventor陈坚张传志堵国成康振关泽宇
OwnerJIANGNAN UNIV