Gene detection kit for Hong Kong alpha-thalassemia
A technology for thalassemia and gene detection, applied in the fields of biology and medicine, can solve the problems of high detection cost, difficulty in popularization and application, errors and error correction of sequencing platforms, etc.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0045] Embodiment a test kit of the present invention is formed
[0046] 1. Primer design and screening:
[0047] According to the α-globin homology relationship, primers were designed in the relatively conserved sequence region of the fusion gene formed by α2 and α1; the nucleic acid sequence of the conserved sequence is:
[0048] SEQ ID NO: 1:
[0049] CTCAGGGAGTCCCAGCATCGCCACCCTCCTTTGAAATCTCCCTGGTTGAACCCAGTTAACATACGCTCTCCATCAAAACA
[0050] AAACGAAACAAAACAAACTAGCAAAATAGGCTGTCCCCAATGCAAGTGCAGGTGCCAGAACATTTCTCTCATTCTCACCC
[0051] CTTCCTGCCAGAGGGTAGGTGGCTGGAGTGAGGGTGCTGGCCCTACTCACACTTCCTGTGTCATGGTGACCCTCTGAGAG
[0052] CAGCCCCAGTCAGTGGGGAAGGAGGAAGGGGCTGGGATGCTCACAGCCGGCAGCCCACACCTGGGGAGACTCTTCAGCAGA
[0053] GCACCTTGCGGCCTTACTCCTGCACGTCTCCTGCAGTTTGTAAGGTGCATTCAGAACTCACTGTGTGCCCAGCCCTGAGC
[0054] TCCCAGCTAATTGCCCCACCCAGGGCCTCTGGGACCTCCTGGTGCTTCTGCTTCCTGTGCTGCCAGCAACTTCTGGAAAC
[0055] GTCCCTGTCCCCGGTGCTGAAGTCCTGGAATCCATGCTGGGAAGTTGCACAGCCCATCTGGCTCTCAGCCAGCCTAGGAA
[00...
Embodiment 2
[0084] The use effect of embodiment two kits of the present invention
[0085] The present invention directly adopts Gap-PCR technology to detect Hong Kong type α-thalassemia (HKαα), using the kit of the present invention, can directly detect HKαα thalassemia gene defects, compared with prenatal diagnosis using nested PCR combined with genetic analysis operations Simple, time-saving and cost-effective.
[0086] The present invention further clarifies the structure of the HKαα gene, which is composed of an α2 gene, a fusion gene formed by X1 and X2, and a fusion gene formed by α2 and α1, creating conditions for a more comprehensive screening of thalassemia. Premarital, prenatal testing and α-thalassemia diagnosis of fetuses during pregnancy provide scientific basis.
[0087] 1. The testing situation of the kit of the present invention to clinical samples:
[0088] 10 cases of Hong Kong type α-thalassemia (HKαα) and 40 cases of other genotypes and normal samples were detected ...
example 3
[0107] The clinical application of example three kits of the present invention
[0108] 1. Purpose
[0109] Detect the rare genotype HKαα in α-thalassemia, realize the qualitative detection of HKαα, and provide a reliable basis for genetic screening of thalassemia. One parent is -α when doing genetic analysis 3.7 / αα, the other side is -- SEA / αα, the child born with the α-thalassemia detection kit of Yaneng Biotechnology (Shenzhen) Co., Ltd. has three electrophoresis bands of 2.0kb, 1.8kb, and 1.3kb, which can be used for HKαα detection.
[0110] 2. Inspection principle
[0111] This kit is based on the technical principle of PCR combined with agarose gel electrophoresis, and performs specific amplification in the relatively conserved region of the fusion gene to achieve qualitative detection of HKαα genotype.
[0112] 3. The main components are shown in Table 6.
[0113] Table 6
[0114]
[0115] 4. Applicable instruments
[0116] PCR gene amplification instrument:...
PUM
| Property | Measurement | Unit |
|---|---|---|
| Sensitivity | aaaaa | aaaaa |
Abstract
Description
Claims
Application Information
Login to View More 