Unlock instant, AI-driven research and patent intelligence for your innovation.

Gene detection kit for Hong Kong alpha-thalassemia

A technology for thalassemia and gene detection, applied in the fields of biology and medicine, can solve the problems of high detection cost, difficulty in popularization and application, errors and error correction of sequencing platforms, etc.

Active Publication Date: 2014-03-19
亚能生物技术(深圳)有限公司
View PDF5 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0010] 1. Southern blot hybridization-restriction zymography analysis: used to be the main method for α-thalassemia gene diagnosis, but due to the cumbersome operation and long time required, it is generally only suitable for research use and not suitable for clinical application
[0011] 2. Probe Ligation Amplification Technology (MLPA): MLPA was developed in 2002. This method can detect all missing genotypes and unknown genotypes. It is highly efficient and specific, and can detect multiple in the same reaction tube. Up to 45 different nucleic acid sequence copy number changes; commonly used in the detection of α-deletion genes, but due to the high cost of detection, cumbersome operation, and long time-consuming, the detection process lasts up to 16 hours, and requires special equipment, generally only used for For research use, it is not convenient for the promotion and application of molecular screening methods
[0012] 3. Sequencing technology: The direct analysis of DNA sequences by sequencing technology has always been considered as the gold standard for clinical testing; at present, sequencing technology is facing the problem of standardization and certification of sample processing (nucleic acid extraction) amplification, signal detection, and specific errors in sequencing platforms and error correction problems, as well as possible problems in bioinformatics, clinical verification procedures and standardization problems, etc., have not been effectively resolved, so they have not been widely used in clinical practice.
In the detection of thalassemia, the reports are limited to the detection of one genotype, and the workload is heavy. Since the probe needs to be fluorescently labeled, the detection cost is high
[0016] 7. PCR-oligonucleotide probe (ASO) method: This technology can quickly and easily detect known mutations of the thalassemia gene (α T and beta T ), with high sensitivity and accuracy, but one hybridization can only detect one mutation, and also requires isotope probes, which is difficult to popularize and apply
[0021] 3. In the existing patented technology of α-thalassemia detection products, there is no detection directly for HKαα
[0022] 4. At present, the detection of HKαα thalassemia is based on clinical phenotype, with the help of existing thalassemia detection kits combined with genetic analysis of parental genotypes. There is no fast and direct method for detecting HKαα thalassemia

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Gene detection kit for Hong Kong alpha-thalassemia
  • Gene detection kit for Hong Kong alpha-thalassemia
  • Gene detection kit for Hong Kong alpha-thalassemia

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0045] Embodiment a test kit of the present invention is formed

[0046] 1. Primer design and screening:

[0047] According to the α-globin homology relationship, primers were designed in the relatively conserved sequence region of the fusion gene formed by α2 and α1; the nucleic acid sequence of the conserved sequence is:

[0048] SEQ ID NO: 1:

[0049] CTCAGGGAGTCCCAGCATCGCCACCCTCCTTTGAAATCTCCCTGGTTGAACCCAGTTAACATACGCTCTCCATCAAAACA

[0050] AAACGAAACAAAACAAACTAGCAAAATAGGCTGTCCCCAATGCAAGTGCAGGTGCCAGAACATTTCTCTCATTCTCACCC

[0051] CTTCCTGCCAGAGGGTAGGTGGCTGGAGTGAGGGTGCTGGCCCTACTCACACTTCCTGTGTCATGGTGACCCTCTGAGAG

[0052] CAGCCCCAGTCAGTGGGGAAGGAGGAAGGGGCTGGGATGCTCACAGCCGGCAGCCCACACCTGGGGAGACTCTTCAGCAGA

[0053] GCACCTTGCGGCCTTACTCCTGCACGTCTCCTGCAGTTTGTAAGGTGCATTCAGAACTCACTGTGTGCCCAGCCCTGAGC

[0054] TCCCAGCTAATTGCCCCACCCAGGGCCTCTGGGACCTCCTGGTGCTTCTGCTTCCTGTGCTGCCAGCAACTTCTGGAAAC

[0055] GTCCCTGTCCCCGGTGCTGAAGTCCTGGAATCCATGCTGGGAAGTTGCACAGCCCATCTGGCTCTCAGCCAGCCTAGGAA

[00...

Embodiment 2

[0084] The use effect of embodiment two kits of the present invention

[0085] The present invention directly adopts Gap-PCR technology to detect Hong Kong type α-thalassemia (HKαα), using the kit of the present invention, can directly detect HKαα thalassemia gene defects, compared with prenatal diagnosis using nested PCR combined with genetic analysis operations Simple, time-saving and cost-effective.

[0086] The present invention further clarifies the structure of the HKαα gene, which is composed of an α2 gene, a fusion gene formed by X1 and X2, and a fusion gene formed by α2 and α1, creating conditions for a more comprehensive screening of thalassemia. Premarital, prenatal testing and α-thalassemia diagnosis of fetuses during pregnancy provide scientific basis.

[0087] 1. The testing situation of the kit of the present invention to clinical samples:

[0088] 10 cases of Hong Kong type α-thalassemia (HKαα) and 40 cases of other genotypes and normal samples were detected ...

example 3

[0107] The clinical application of example three kits of the present invention

[0108] 1. Purpose

[0109] Detect the rare genotype HKαα in α-thalassemia, realize the qualitative detection of HKαα, and provide a reliable basis for genetic screening of thalassemia. One parent is -α when doing genetic analysis 3.7 / αα, the other side is -- SEA / αα, the child born with the α-thalassemia detection kit of Yaneng Biotechnology (Shenzhen) Co., Ltd. has three electrophoresis bands of 2.0kb, 1.8kb, and 1.3kb, which can be used for HKαα detection.

[0110] 2. Inspection principle

[0111] This kit is based on the technical principle of PCR combined with agarose gel electrophoresis, and performs specific amplification in the relatively conserved region of the fusion gene to achieve qualitative detection of HKαα genotype.

[0112] 3. The main components are shown in Table 6.

[0113] Table 6

[0114]

[0115] 4. Applicable instruments

[0116] PCR gene amplification instrument:...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
Sensitivityaaaaaaaaaa
Login to View More

Abstract

The invention relates to the technical field of biology and medicament, and particularly relates to a gene detection kit for Hong Kong alpha-thalassemia. According to the invention, the gene sequence of HK alpha alpha fusion gene is further confirmed and compared with alpha-globin sequence for analysis, and primer design is carried out in a conserved sequence area of the fusion gene. The technical scheme of the invention is to provide a gene detection kit for Hong Kong alpha-thalassemia, comprising a PCR (polymerase chain reaction) solution, wherein the PCR solution contains primer HK alpha alpha-F and HK alpha alpha-R, the primer is designed aiming at the conserved sequence area of the HK alpha alpha fusion gene, and the nucleotide sequence of the conserved sequence of the HK alpha alpha fusion gene is shown in SEQ ID NO:1. The kit disclosed by the invention can be directly used for kits for HK alpha alpha detection and can specifically, quickly and stably diagnose HK alpha alpha gene type.

Description

technical field [0001] The invention relates to the technical field of biology and medicine, in particular to a kit for rapidly detecting Hong Kong-type α-thalassemia (HKαα) in clinical samples. Background technique [0002] α-Thalassemia (hereinafter referred to as α-thalassemia) is a group of genetic hemolytic hemoglobinopathies characterized by reduced or non-synthesized α-globin chains and an imbalance in the ratio of α-chain / non-α-chain. Thalassemia is one of the most common human monogenic blood diseases in the world. It is listed by the World Health Organization as six common diseases that endanger human health. It is also the most common and most harmful genetic disease in southern China. In the high-incidence areas of α-thalassemia in southern my country, the epidemiological survey of 900,000 people showed that the total incidence rate was 2.46%, and the incidence rates in Guangxi, Guangdong, Jiangxi, Sichuan and Zhejiang provinces (regions) were 14.95% respectively...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12Q1/68
Inventor 梁少明李长远刘晶晶任维
Owner 亚能生物技术(深圳)有限公司
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More