Check patentability & draft patents in minutes with Patsnap Eureka AI!

Nucleic acid detection method based on DNA (Deoxyribonucleic Acid) hairpin and RCA (Rolling Circle Amplification)

A detection method and nucleic acid technology, which are applied in biochemical equipment and methods, and the determination/inspection of microorganisms, can solve the problems of unfavorable detection methods, high cost, expensive modification of fluorescent molecules and fluorescent quenching molecules, etc. The effect of reducing detection cost, high sensitivity, and reducing the use of biological reagents

Inactive Publication Date: 2013-04-03
PEKING UNIV
View PDF3 Cites 9 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, the modification of fluorescent molecules and fluorescence quenching molecules is expensive, and the cost of molecular detection is too high, which is not conducive to the popularization and use of detection methods.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Nucleic acid detection method based on DNA (Deoxyribonucleic Acid) hairpin and RCA (Rolling Circle Amplification)
  • Nucleic acid detection method based on DNA (Deoxyribonucleic Acid) hairpin and RCA (Rolling Circle Amplification)
  • Nucleic acid detection method based on DNA (Deoxyribonucleic Acid) hairpin and RCA (Rolling Circle Amplification)

Examples

Experimental program
Comparison scheme
Effect test

Embodiment Construction

[0028] The method for calculating and quantifying detection by using DNA hairpin and RCA will be further described below in conjunction with specific examples.

[0029] 1. Design and synthesis of DNA hairpin

[0030] name DNA sequence (5'-3' end) DNA Hairpin CCTGTCTTCGCCTTGGCCACAGTGGTACGCGAGGCCACCACGAAGGCGAAGACAGGTGCTTAGTC target DNA TCGTGGTGGCCTCGCGTACCACTGTGGCCA circular DNA TGTCTTCGCCTTGTTTCCTTTCCTTGAAACTTCTTCCTTTCTTTCTTTCGACTAAGCACC

[0031] 2. DNA hairpin modification to nanoparticles

[0032] 1) Take 80ul of silica nanoparticle solution (10mg / ml), centrifuge at 10000rpm / min for 3min, discard the supernatant, wash with washing / binding buffer three times, each time with 80ul, centrifuge at 10000rpm / min after washing, 3min, add 16ul washing / binding buffer after the last centrifugation;

[0033] 2) Add 4ul of DNA hairpin solution (100uM) to the above particle solution, place it on a constant temperature oscillating metal bath, and react...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a nucleic acid detection method based on a DNA (Deoxyribonucleic Acid) hairpin and RCA (Rolling Circle Amplification). The detection method comprises the steps of: modifying the DNA hairpin to a solid carrier, wherein the circular part of the DNA hairpin is complementary with a target DNA and the stem part of the DNA hairpin is complementary with an an annular DNA; adding the annular DNA, an enzyme, an amplification raw material and the like; complementing and pairing a target nucleic acid molecule and the loop of the DNA hairpin when the target nucleic acid molecule is added into a detection system; opening a hairpin-loop structure; hybridizing a base of the hairpin and the circular DNA; performing RCA; opening different hairpin-loop structures when the target nucleic acid molecular weights are different; and quantifying the target nucleic acid molecule by using an optical or electric method. According to the nucleic acid detection method, as the DNA hairpin is used as a detection probe of RCA, the step of detecting the molecule by RCA is simplified, the detection cost is reduced, the advantage of high sensitivity of RCA for nucleic acid detection is simultaneously kept, and the nucleic acid detection method is suitable for popularization and use.

Description

technical field [0001] The invention belongs to the field of biomolecular detection, and in particular relates to a method for realizing rapid and highly sensitive detection of nucleic acid molecules based on DNA hairpin and rolling circle amplification (RCA). Background technique [0002] Rolling circle amplification (RCA) is a newly developed isothermal nucleic acid amplification method. Using circular DNA as a template, dNTPs are converted into single-stranded DNA under the catalysis of a special DNA polymerase (phi 29 DNA polymerase) through a short DNA primer (complementary to a part of the circular template). Its linear amplification factor is 10 5 , the exponential amplification ability is greater than 10 9 , realize the signal amplification of the target nucleic acid, and the sensitivity reaches one copy of the nucleic acid molecule, which has great application value and potential in nucleic acid detection. For example, Juan Hu et al. (Juan Hu, Chun-yang Zhang; Se...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12Q1/68
Inventor 桑建明王玮
Owner PEKING UNIV
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More