Method for detecting Pseudomonas syringae causing kiwi canker by loop-mediated isothermal amplification

A ring-mediated isothermal, canker technology, applied in the field of plant bacteriology, can solve the problems of low accuracy, low sensitivity, complicated operation, etc., and achieve the effect of reducing detection cost and improving detection efficiency

Inactive Publication Date: 2013-04-17
NORTHWEST A & F UNIV
View PDF2 Cites 13 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, the above methods have different disadvantages, for example, the required test period is long, the operation is cumbersome, the

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for detecting Pseudomonas syringae causing kiwi canker by loop-mediated isothermal amplification
  • Method for detecting Pseudomonas syringae causing kiwi canker by loop-mediated isothermal amplification
  • Method for detecting Pseudomonas syringae causing kiwi canker by loop-mediated isothermal amplification

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0048] 1. Primer Design

[0049] First, the inventor downloaded the ITS gene sequence of X. kiwifruit canker bacterium from NCBI, used Primer4.0 (http: / / primerexplorer.jp / e / v4_manual / index.html) to design multiple sets of primers, and then according to the sequence region where the primers were located Primers for each virus were selected based on comprehensive factors such as the conservation of the virus, the hairpin structure of the primers, the GC content of the dimer, and the Tm value. Finally, 6 primers were selected for X. kiwifruit, including 2 outer primers (F3 and B3), 2 inner primers (FIP and BIP) and two loop primers (LF and LB). The primers refer to SEQ ID NO.1-6. See Table 1 for primer information.

[0050] The information of the primer sequence SEQ ID NO.1-6 of table 1:

[0051] Primer name serial number Sequence 5'-3' Psa-F3 SEQ ID NO.1 CCGATTTTGGGTCTGTAGCT Psa-B3 SEQ ID NO.2 GTAAGTGGTGGAGCCAAGC Psa-FIP SEQ ID NO.3 CG...

Embodiment 2

[0058] Example 2 , PCR and LAMP methods to detect field samples:

[0059] At present, there are few molecular detection methods for X. kiwifruit canker bacterium. Referring to the three pairs of primers of Rees-George et al., PCR sequencing and LAMP were used to detect multiple field samples. The results of the two methods were very different. LAMP The method is obviously much higher in specificity and accuracy than the PCR method.

[0060] The LAMP detection method does not require expensive instruments and equipment, the operation procedure is simple, and it has the characteristics of fast, efficient, high specificity, and high sensitivity. Its application range is becoming wider and wider, and it has exerted great advantages in the detection of pathogenic microorganisms It has been successfully applied in the related research of tumor genes. Using the LAMP method described in this experiment and the PCR sequencing method to simultaneously detect multiple samples of field...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention relates to a method for detecting Pseudomonas syringae causing kiwi canker by loop-mediated isothermal amplification (LAMP), wherein the method comprises the following steps: extracting DNA of Pseudomonas syringae and performing LAMP and real-time turbidity detection. In the LAMP, six primers shown as SEQ ID NO.1-6 are used, and the screening and detection of Pseudomonas syringae causing kiwi canker is at the molecular level, wherein Pseudomonas syringae causing kiwi canker is derived from the Shaanxi Province. The LAMP primers are designed according to the ITS gene of Pseudomonas syringae causing kiwi canker, and the method of detecting Pseudomonas syringae causing kiwi canker is rapid, sensitive and highly-specific by use of the LAMP techniques. The method provides a new approach to rapid detection of Pseudomonas syringae causing kiwi canker.

Description

technical field [0001] The invention belongs to the technical field of plant bacteriology, and in particular relates to a method for detecting kiwifruit canker pathogen by adopting a loop-mediated isothermal amplification technique. Background technique [0002] my country is the main producing area of ​​kiwifruit, and its planting area and output both rank first in the world. The production of kiwifruit in Shaanxi Province ranks first in the country. Kiwifruit canker has occurred in various degrees in the major producing areas of kiwifruit in my country, which seriously threatens the production of kiwifruit and has been listed as the national forest plant quarantine object. The disease is ferocious, and it is a devastating disease. When it occurs, it not only reduces the yield, but also causes the skin to become thicker, the fruit taste sour, the fruit to become smaller, the shape of the fruit to be different, the quality to decline, and the commodity value to decrease, ca...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
IPC IPC(8): C12Q1/68C12Q1/04C12R1/38
Inventor 赵磊郝兴安樊红科吴云锋
Owner NORTHWEST A & F UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap