MiR-15a target site sequence and application of miR-15a target site sequence in restraining hepatitis B virus replication
A hepatitis B virus, 1.mir-15a technology, applied in the fields of molecular biology and antivirology, can solve the problems affecting the occurrence of liver cysts and other problems, and achieve the effect of inhibiting replication
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0062] Example 1: Effects of protein components Ago2 and Dicer in knock-down miRNA's pathway on the replication of HBV.
[0063] The siRNA for knock-down Ago2 and Dicer is as follows: (Shanghai Gemma Biotechnology Co., Ltd.)
[0064] si Ago2: 5'-GCACGGAAGUCCAUCUGAATT-3';
[0065] si Dicer: 5'-UGCUUGAAGCAGCUCUGGA-3'.
[0066] Plasmid pCH9-3091 used in the present invention (NassalM. The arginine-rich domain of the hepatitis B virus core protein is required for pre-genome encapsidation and productive viral positive strand DNA synthesis but not for virus assembly [J]. J Viro, 11992, 66(7):4107-4116.) contains the whole genome of HBV, and after the plasmid is transfected into HepG2 cells for 48 hours, HBV virus particles will be produced.
[0067] 1. Transfection of siRNA and plasmid pCH9-3091:
[0068] The following transfection operation takes a 24-well plate as an example, and the whole process of transfection must be strictly aseptic.
[0069] 1. First, mix 1ul siAgo2 or s...
Embodiment 2
[0106] Example 2: Mix chemically synthesized miR-15a mimic and miR-15a inhibitor with plasmid pCH9-3091, and transfect into HepG2 cells through lipofectamine2000 liposome reagent. After 2-3 days, pass ELISA Detection of HbsAg and HbeAg secreted by HBV.
[0107] The transfection process and conditions were the same as in Example 1. The sequence of miR-15a mimic is: 5'-uagcagcacauaauguuugug-3'; the sequence of miR-15a inhibitor is: 5'-cacaaaccauuaugugcugcua-3.
[0108] The process and conditions of RT-PCR were the same as in Example 1. Reverse transcription primers for miR-15a:
[0109] GTCGTATCCAGTGCGTGTCGTGGAGTCGGCAATTGCACTGGATACGACCACAAACC;
[0110] The quantitative primers for miR5a are: miR-15aF, TAGCAGCACATAATGGTTTGTG; miR5aR: TGCGTGTCGTGGAGTC;
[0111] The internal reference is actin, and the quantitative primers are actinF: cgtggacatccgcaaagac; actinR: tggaaggtggacagcgaggc. After the reaction, the software that comes with Rotors gene was used for data analysis.
[...
Embodiment 3
[0114] Example 3: Prediction of miR-15a has miR15a-targeted sequences in the p region of HBV.
[0115] Using the biological software Target scan (Lewis et al., 2005) to predict the target sequence of miR5a on the HBV genome, the results are as follows image 3 Shown: 4 potential target sites of miR-15a were predicted on the HBV genome using the software mentioned above, and their specific positions are as follows. There are three sites in the CDS region of HBp, and the specific positions on the HBV genome are respectively Yes: 2645-2666bp, 2677-2698bp and 2686-2707bp. The fourth site is located in the overlapping region of HBp and HBx, and the specific position on the HBV genome is 2900-2921bp. The present invention will determine this target site and prepare a mutation vector containing the target site PRL-HBX- mut, the carrier carries out corresponding base mutations at potential target sites in the HBx region, as shown by the arrows in the figure: T to G, T to C.
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More