Oncolytic adenoviral vectors and methods and uses related thereto

A technology of oncolytic adenovirus and adenovirus, applied in the field of life science and medicine, to improve the effect of cancer therapy

Inactive Publication Date: 2013-07-24
ONCOS THERAPEUTICS
View PDF4 Cites 29 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

In addition, deletions of other regions as well as additional mutations have conferred additional properties to viral vectors

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Oncolytic adenoviral vectors and methods and uses related thereto
  • Oncolytic adenoviral vectors and methods and uses related thereto
  • Oncolytic adenoviral vectors and methods and uses related thereto

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0136] Example 1. Cloning of Ad5 / 3-hTERT-E1A-hCD40L, Ad5 / 3-CMV-hCD40L and Ad5 / 3-CMV-mCD40L

[0137] Using standard adenovirus preparation techniques (Kanerva A, et al., Mol Ther 2002; 5:695-704; Bauerschmitz GJ, et al., Mol Ther 2006; 14:164-74; Kanerva A and Hemminki A., Int J Cancer 2004; 110: 475-80; Volk AL, et al., Cancer Biol Ther 2003; 2:511-5) produced and amplified Ad5 / 3-hTERT-E1A-hCD40L (SEQ ID. NO:5). Briefly, using specific primers (forward primer: TTTAACATCTCTCCCTCTGTGATT; SEQ ID NO: 3 and reverse primer: TATAAATGGAGCTTGACTCGAAG; SEQ ID NO: 4) (characterized by the insertion of specific restriction sites SunI / MunI) by polymerization Human CD40L cDNA was amplified by enzyme chain reaction (PCR) (a kind gift from Prof Eliopoulos, University of Crete, Heraklion, Greece). The PCR amplified product was subsequently subcloned into pTHSN (Kanerva A., et al., Gene Ther 2005; 12:87-94), which was then combined with pAd5 / 3-hTERT-E1A (Bauerschmitz GJ, et al., Cancer Res 200...

Embodiment 2

[0141] Example 2. Expression and functionality of constructed adenoviruses: in vitro and in vivo

[0142] hCD40L expression was studied using flow cytometry and enzyme-linked immunosorbent assay (ELISA). For flow cytometry analysis, human embryonic kidneys were infected with Ad5 / 3-hTERT-E1A-hCD40L or Ad5 / 3-CMV-hCD40L at 10 VP / cell in growth medium containing 2% fetal calf serum (FCS) 293 cells. Control cells were treated with 2% Dulbecco's Modified Eagle's Medium (DMEM) alone (mock test). After 24 hours, cells were stained with hCD40L-FITC (555699, BD Biosciences Pharmingen Franklin Lakes, NJ) antibody for 30 minutes, or stained with an isotype control (IC) to measure the expression from cell autofluorescence and non-antigen-specific binding. Bottom fluorescence. Flow cytometry analysis was performed on a BDLSR (BD Biosciences, Franklin Lakes, NJ).

[0143] For ELISA analysis, A549 xenografts and syngeneic MB49 tumors were induced and treated with Ad5 / 3-hTERT-E1A-hCD40L, A...

Embodiment 3

[0151] Example 3. In vitro evaluation of the oncolytic efficacy of the constructed adenovirus

[0152]To evaluate the oncolytic potency of the constructed adenovirus, EJ (CD40+) and A549 (CD40-) cell lines were used. In the cell viability assay, different concentrations (0.1, 1, 10, 100, 1000 VP / cell) of Ad5 / 3-hTERT-E1A-hCD40L, Ad5 / 3-CMV-hCD40L and their controls suspended in 2% DMEM were used Viruses Ad5 / 3-hTERT-E1A and Ad5 / 3-Luc1 infect cells in 96-well plates. After 1 hour, cells were washed and incubated for 7 days in growth medium containing 5% FCS. Cell viability was subsequently analyzed using the MTS assay (Cell Titer96A Queous One Solution Proliferation Assay, Promega).

[0153] For Ad5 / 3-hTERT-E1A-hCD40L, complete cell killing was seen in the EJ (CD40+) cell line at 1000 viral particles / cell (VP / cell) ( image 3 b). In the A549(CD40-) cell line, the oncolytic potency of Ad5 / 3-hTERT-E1A-hCD40L was slower than that of the control virus Ad5 / 3-hTERT-E1A( image 3 a)...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The present invention relates to the fields of life sciences and medicine. Specifically, the invention relates to cancer therapies. More specifically, the present invention relates to oncolytic adenoviral vectors and cells and pharmaceutical compositions comprising said vectors. The present invention also relates to said vectors for treating cancer in a subject and a method of treating cancer in a subject. Furthermore, the present invention relates to methods of producing CD40L in a cell and increasing tumor specific immune response and apoptosis in a subject, as well as to uses of the oncolytic adenoviral vector of the invention for producing CD40L in a cell and increasing tumor specific immune response and apoptosis, while decreasing tumor-associated immunosuppression, in a subject.

Description

field of invention [0001] The present invention relates to the fields of life science and medicine. In particular, the invention relates to cancer therapy. More specifically, the present invention relates to oncolytic adenoviral vectors as well as cells and pharmaceutical compositions comprising said vectors. The invention also relates to said vectors for use in treating cancer in a subject and methods for treating cancer in a subject. In addition, the present invention relates to methods for producing CD40L in cells and enhancing tumor-specific immune responses and apoptosis in a subject, and oncolytic adenoviral vectors for producing CD40L in cells and enhancing tumor-specific immune responses in subjects Use in immune response and apoptosis. Background of the invention [0002] Cancer can be treated with surgery, hormonal therapy, chemotherapy, radiation therapy, and / or other therapies, but in many cases, it is often characterized by advanced cancer that cannot be cure...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C07K14/705C12N15/861
CPCC12N2710/10332C12N2810/6018C12N2710/10343C12N2710/10371C07K14/70575C12N15/86A61P35/00A61P35/02A61P37/02A61P43/00C12N15/861C07K14/705A61K38/191A61K48/0058
InventorI·迪亚科努S·佩索宁A·海明基V·切鲁洛
OwnerONCOS THERAPEUTICS