Clostridium difficile exotoxin B carboxyl-terminal protein gene highly expressing in Escherichia coli

A carboxy-terminal protein, Clostridium difficile technology, applied in the field of Clostridium difficile exotoxin B carboxy-terminal gene and its high-efficiency expression in E. Production and other issues to achieve efficient expression and reduce synthesis costs

Active Publication Date: 2015-06-24
SHANDONG INT BIOTECH PARK DEV
View PDF3 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0004] However, the expression level of the existing Clostridium difficile exotoxin B carboxy-terminal gene in Escherichia coli is low, which affects the production of Clostridium difficile exotoxin B carboxy-terminal gene

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Clostridium difficile exotoxin B carboxyl-terminal protein gene highly expressing in Escherichia coli
  • Clostridium difficile exotoxin B carboxyl-terminal protein gene highly expressing in Escherichia coli
  • Clostridium difficile exotoxin B carboxyl-terminal protein gene highly expressing in Escherichia coli

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0012] Example 1 Codon-optimized Clostridium difficile exotoxin B carboxy-terminal gene sequence design and synthesis

[0013] 1. Design and synthesize the nucleotide sequence (toxB-C) of SEQ ID NO.1, carry out artificial synthesis and sequencing of the whole gene, and use it for the construction experiment of prokaryotic expression vector after confirmation;

[0014] 2. Acquisition of the target gene fragment: after the gene toxB-C was synthesized, it was subcloned into a pUCE plasmid (commercially purchased from a gene company) to form a subcloning plasmid pUCE-toxB-C for amplification, and then subcloned by double digestion with EcoRV and XhoI The plasmid pUCE-toxB-C was recovered by gel electrophoresis to obtain the target sequence fragment with a molecular weight of about 1770bp.

[0015] 3. Prokaryotic vector pET32b (+) acquisition: design PCR primers:

[0016] Forward primer: AAGCTTGCGGCCGCACTCGAGCACCA

[0017] Reverse primer: CATACCAGAACCGCGTGGCACCAGA

[0018] The p...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a Clostridium difficile exotoxin B carboxyl-terminal protein gene highly expressing in Escherichia coli, and its high expression method in Escherichia coli. The optimization of the Clostridium difficile exotoxin B carboxyl-terminal protein gene in the invention improves the influences of a plurality of duplicate blocks of an original sequence to the chemical gene synthesis and reduces the synthesis cost, the gene can highly express in Escherichia coli, and the expression level can reach 70% of total mycoproteins, and is far higher than that of present Clostridium difficile exotoxin B carboxyl-terminal protein genes.

Description

technical field [0001] The invention belongs to the technical field of biomedicine, and relates to a Clostridium difficile exotoxin B carboxyl terminal gene highly expressed in Escherichia coli and a high-efficiency expression method in Escherichia coli. Background technique [0002] Clostridium difficile is a Gram-positive, spore-forming, obligate anaerobic Clostridium bacterium that is currently a major cause of nosocomial infections. C. difficile infection is contact-transmitted and colonizes the colon by the oral-fecal route, through direct contact with patients, contaminated equipment or objects (such as bedpans, baths, and electronic rectal thermometers), through indirect contact with healthcare workers, through Incubation periods ranging from a few days to 8 weeks lead to nosocomial outbreaks of Clostridium difficile infection. The difficulty in the treatment of Clostridium difficile is that the dormant spores can tolerate a variety of disinfectants, allowing them to...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityPatents(China)
IPC IPC(8): C12N15/31C12N15/70C07K14/33
Inventor冯东晓张淑敏刘红董创创邢平平赵志伟李敏孙君波
OwnerSHANDONG INT BIOTECH PARK DEV