Fusion protein with clostridium difficile toxins A/B and encoding gene and application of fusion protein

A Clostridium difficile toxin and fusion protein technology, applied in the direction of anti-bacterial immunoglobulin, DNA/RNA fragments, bacteria, etc., can solve the problems of heavy workload and high difficulty in research and development, and achieve the effect of reducing difficulty and cost

Active Publication Date: 2014-05-07
冯东晓
View PDF2 Cites 7 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0005] The purpose of the present invention is to provide a fusion protein of Clostridium difficile toxin A / B, which aims to solve the problems of heavy workload and high difficulty in research and development of respectively expressing and purifying Clostridium difficile toxin A and Clostridium difficile toxin B

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Fusion protein with clostridium difficile toxins A/B and encoding gene and application of fusion protein
  • Fusion protein with clostridium difficile toxins A/B and encoding gene and application of fusion protein
  • Fusion protein with clostridium difficile toxins A/B and encoding gene and application of fusion protein

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0033] Example 1 The codon-optimized coding gene sequence is the construction of SEQ ID NO: 1

[0034] like figure 1As shown, the 792bp of the receptor binding region at the carboxy-terminal of toxinA and the 1770bp of the carboxy-terminal of toxinB are connected by a flexible chain of 18 amino acids to form a fusion protein sequence of C-AB, including the following specific steps: Select the Clostridium difficile exotoxin A (ToxinA) gene Carboxy-terminal 972 base sequences (total encoding 324 amino acids), Clostridium difficile exotoxin B (ToxinB) gene carboxy-terminal 1770 base sequences (total encoding 590 amino acids), analyze the coding sequence, find out the influence of gene synthesis The repeat sequence of is shown in SEQ ID NO:6. Simultaneously analyze the sites with different codon usage preferences in this sequence and E. coli, and replace low-frequency codons with high-frequency codons; in addition, on the basis of taking into account the codon preferences of E. ...

Embodiment 2

[0062] Example 2 Prokaryotic expression vector construction

[0063] 1. Construction and identification of prokaryotic expression vector pET32b(+)-toxA-toxB

[0064] 1. Obtaining the target gene fragment: design a set of PCR primers to amplify the nucleotide sequences of Clostridium difficile exotoxin SEQ ID NO:3 and SEQ ID NO:4 of the synthesized pUCE-toxA-toxB, wherein the 5' end is blunt , the 3' end introduces a NruI restriction site. The PCR product purification kit recovers the product after the PCR reaction, and then releases the C. difficile exotoxin A carboxy-terminal and exotoxin B carboxy-terminal gene fragments containing cohesive ends at the 3' end after digestion with NruI. The primer sequences for amplifying the C-terminal gene fragments of Clostridium difficile exotoxin A and exotoxin B are as follows, and the reverse primer is introduced into the NruI restriction site "TCGCGA":

[0065] Forward primer 1: GCCTCTACAGGATATACAAGTA

[0066] Reverse primer 1: GTG...

Embodiment 3

[0072] Expression of the fusion protein of embodiment 3 Clostridium difficile toxin A / B

[0073] 1. Induced expression and identification: The identified pET32b(+)-toxA-toxB plasmid was transformed into E. coli host strain BL21(DE3) by calcium chloride method, and a single colony was randomly selected for expression. That is, a single colony was picked with a sterile pipette tip and cultured overnight at 37°C in LB medium containing 100 μg / ml Amp, with the rotational speed set at 220 rpm. The next morning, inoculate in fresh LB medium at 1:10, culture at 37°C, 220rpm until the OD value is about 0.6, add IPTG to a final concentration of 0.4mM, induce at 22°C, and set the induction time separately For 3h and 8h, samples were taken for 8% SDS-PAGE electrophoresis detection, and the results were as follows: Figure 5 shown in Figure 5 Among them, lanes 1 to 7 are the expression of pET32b(+)-toxA-toxB in BL21(DE3) strain: 1 is 30°C induction for 1 hour, 3 is before induction at ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a fusion protein with clostridium difficile toxins A / B and an encoding gene and application of the fusion protein. The sequence of the fusion protein with the clostridium difficile toxins A / B is represented by SEQ ID NO:2, and the encoding gene is represented by SEQ ID NO:1. According to the fusion protein, a carrier fragment consisting of a clostridium difficile toxin A carboxyl terminal gene and a prokaryotic expression vector pET32b(+) which are modified through a codon and a fusion gene fragment consisting of a clostridium difficile toxin B carboxyl terminal structure and a flexible chain are obtained through PCR (polymerase chain reaction) multiplication segmentation; the obtained fusion fragment and the obtained carrier are respectively connected in an enzyme recycling manner, so that a recombined expression plasmid pET32b(+)-ToxA-ToxB can be obtained; after the recombined plasmid converts a host BL21(DE3) strain, the recombined plasmid can be subjected to induction expression by IPTG (isopropyl-beta-d-thiogalactoside) to obtain the fusion protein with the clostridium difficile toxins A / B. According to the fusion protein with the clostridium difficile toxins A / B, the fusion protein with the immunogenicity of the toxins A and B can be obtained, and the difficulty and the cost for researching and producing a CDAD (clostridium difficile associated diarrhea) vaccine can be reduced.

Description

technical field [0001] The invention belongs to the field of biological immunology, and in particular relates to a fusion protein of Clostridium difficile toxin A / B, its coding gene and its application. Background technique [0002] The incidence of Clostridium difficile-associated diarrhea (CDAD) has been increasing in recent years and has become the main cause of nosocomial diarrhea. The current treatment for antibiotic-associated diarrhea in the hospital is to use antibiotics such as vancomycin or metronidazole. Usually, antibiotics can effectively treat CDAD, but about 20-30% of recurrent patients cannot be treated due to drug resistance of the strain . With the increasing virulence of strains and resistance to antibiotics, new treatment methods need to be developed, and vaccines and antibody drugs that can neutralize toxins and interfere with the pathogenesis of Clostridium difficile are the main development directions for CDAD prevention and treatment. [0003] Toxin...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C07K19/00C07K16/12C07K1/22C12N15/62C12N15/70C12N1/21G01N33/53A61K39/08A61P31/04A61P1/12
Inventor冯东晓成岩孙君波刘枫杨小平刘红王晓玉张淑敏
Owner冯东晓