Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Non-invasive detection kit for susceptibility gene of chronic lymphocytic leukemia

A detection kit and lymphocyte technology, applied in the field of molecular biology, can solve the problems of increasing the risk of cancer, reducing the ability of DNA damage repair, and reducing the ability of destructive effect.

Inactive Publication Date: 2013-10-30
解码(上海)生物医药科技有限公司
View PDF0 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

When Lys→Gln at position 751 of the XPD gene, the ability to repair DNA damage is reduced, the stability of the genome is reduced, and the ability to resist damage from carcinogens or other external factors is reduced, which increases the risk of cancer

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0021] Example 1. Use of detection kits

[0022] 1. Extract DNA template

[0023] The epithelial cells of the oral mucosa of the subjects were scraped, and the genomic DNA was extracted by the phenol-chloroform method.

[0024] 2. PCR amplification reaction

[0025] Use the PCR reaction component in the detection kit, which contains the following primer pairs:

[0026] (1) XRCC1 (Arg399Gln) forward primer: 5'TGACCTTGCGGGACCTTAG3'

[0027] XRCC1 (Arg399Gln) reverse primer: 5' CCAAGACCCTTTTCACTCCTATC3'

[0028] (2) XPD (Lys751Gln) forward primer: 5' TCCTGCGATTAAAGGCTGTG3'

[0029] XPD (Lys751Gln) reverse primer: 5'TACGGACATCTCCCAAATTCATTC3'

[0030] The reaction system for PCR amplification is: 10×PCR reaction buffer 2.5ml; 25mM dNTP mixture 0.2ml, 5U / ul Taq enzyme 0.125ml, DNA template 1ml (about 12-15ng), 20uM forward primer and reverse primer Each 0.25ml, ddH2O 19.175ml;

[0031] The reaction conditions are: 94°C for 4 minutes for denaturation and enzyme acti...

Embodiment 2

[0044] Example 2. The service of non-invasive genetic testing for people to prevent the onset of chronic lymphocytic leukemia

[0045] 1. Sampling and DNA extraction

[0046] The physicians in the laboratory department of the hospital will guide the subjects to use oral swabs to sample oral epithelial cells, and use the phenol-chloroform method to extract DNA from oral epithelial cells

[0047] 2. Genotype detection

[0048] Using the kit provided by the present invention, the Arg399Gln site on the XRCC1 gene of the subject's genomic DNA, and the two single nucleotide polymorphism sites of the Lys751Gln site on the XPD gene are respectively subjected to DNA sequencing to determine the two SNPs The genotype of the locus.

[0049] 3. Risk assessment of chronic lymphocytic leukemia high-risk groups

[0050]Through the analysis of the SNPs genotypes of the subjects, a risk assessment and analysis report of chronic lymphocytic leukemia susceptibility genes is issued. The report...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a non-invasive detection kit for susceptibility gene of chronic lymphocytic leukemia. The kit comprises a specific primer and a DNA (Deoxyribonucleic Acid) sequencing primer which are used for detecting the genotypes of two single nucleotide polymorphic sites including an Arg399 Gln site on an XRCC1 (X-ray repair cross-complementing group 1) gene and an Lys751 Gln site on an XPD (xeroderma pigmentosum) gene, a PCR (Polymerase Chain Reaction) reaction component, a PCR product purification component and a DNA sequencing reaction component, etc. The kit disclosed by the invention is used for evaluating the suffering risk level of a chronic lymphocytic leukemia patient by detecting the genotypes of the two single nucleotide polymorphic sites closely related with appearance of chronic lymphocytic leukemia, and finally guiding the detected person to pointedly prevent occurrence of chronic lymphocytic leukemia from gene aspect according to the gene detection results of each detected person, thereby reducing the morbidity risk rate of chronic lymphocytic leukemia.

Description

technical field [0001] The invention belongs to the field of molecular biology, relates to medicine and biotechnology, and specifically relates to a chronic lymphocytic leukemia susceptibility gene detection kit, which evaluates the risk level of chronic lymphocytic leukemia from the genetic level according to the detection results, and serves as a preventive and therapeutic method. Direction guide for chronic lymphocytic leukemia. Background technique [0002] Chronic lymphocytic leukemia (CLL) is a monoclonal B lymphocyte proliferation disorder of the hematopoietic system. It is characterized by the accumulation of a large number of small round lymphocytes with uniform shape in peripheral blood, bone marrow, liver and spleen, and lymph nodes, and the clinical manifestation is a chronic process. The disease has no specific symptoms and signs, and the most prominent manifestations are peripheral blood lymphocytosis and lymphadenopathy, which are often discovered due to rou...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12Q1/68
Inventor 潘加奎姜丽
Owner 解码(上海)生物医药科技有限公司
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com