Non-invasive detection kit for susceptibility gene of chronic lymphocytic leukemia
A detection kit and lymphocyte technology, applied in the field of molecular biology, can solve the problems of increasing the risk of cancer, reducing the ability of DNA damage repair, and reducing the ability of destructive effect.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Examples
Embodiment 1
[0021] Example 1. Use of detection kits
[0022] 1. Extract DNA template
[0023] The epithelial cells of the oral mucosa of the subjects were scraped, and the genomic DNA was extracted by the phenol-chloroform method.
[0024] 2. PCR amplification reaction
[0025] Use the PCR reaction component in the detection kit, which contains the following primer pairs:
[0026] (1) XRCC1 (Arg399Gln) forward primer: 5'TGACCTTGCGGGACCTTAG3'
[0027] XRCC1 (Arg399Gln) reverse primer: 5' CCAAGACCCTTTTCACTCCTATC3'
[0028] (2) XPD (Lys751Gln) forward primer: 5' TCCTGCGATTAAAGGCTGTG3'
[0029] XPD (Lys751Gln) reverse primer: 5'TACGGACATCTCCCAAATTCATTC3'
[0030] The reaction system for PCR amplification is: 10×PCR reaction buffer 2.5ml; 25mM dNTP mixture 0.2ml, 5U / ul Taq enzyme 0.125ml, DNA template 1ml (about 12-15ng), 20uM forward primer and reverse primer Each 0.25ml, ddH2O 19.175ml;
[0031] The reaction conditions are: 94°C for 4 minutes for denaturation and enzyme acti...
Embodiment 2
[0044] Example 2. The service of non-invasive genetic testing for people to prevent the onset of chronic lymphocytic leukemia
[0045] 1. Sampling and DNA extraction
[0046] The physicians in the laboratory department of the hospital will guide the subjects to use oral swabs to sample oral epithelial cells, and use the phenol-chloroform method to extract DNA from oral epithelial cells
[0047] 2. Genotype detection
[0048] Using the kit provided by the present invention, the Arg399Gln site on the XRCC1 gene of the subject's genomic DNA, and the two single nucleotide polymorphism sites of the Lys751Gln site on the XPD gene are respectively subjected to DNA sequencing to determine the two SNPs The genotype of the locus.
[0049] 3. Risk assessment of chronic lymphocytic leukemia high-risk groups
[0050]Through the analysis of the SNPs genotypes of the subjects, a risk assessment and analysis report of chronic lymphocytic leukemia susceptibility genes is issued. The report...
PUM

Abstract
Description
Claims
Application Information

- R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com