Unlock instant, AI-driven research and patent intelligence for your innovation.

Molecular marker related to heat-proof character of cow, and application

A technology of molecular markers and heat-resistant traits, applied in the field of molecular markers and applications, can solve problems such as ineffectiveness, uncertain genetic potential of traits, and large influence

Inactive Publication Date: 2013-12-04
INST OF ANIMAL SCI & VETERINARY HUBEI ACADEMY OF AGRI SCI
View PDF2 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, many economic traits of animals are quantitative traits, and their phenotypic traits are controlled by many micro-effect genes and are greatly affected by the environment. Choices are often inefficient or even ineffective

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Molecular marker related to heat-proof character of cow, and application
  • Molecular marker related to heat-proof character of cow, and application
  • Molecular marker related to heat-proof character of cow, and application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0026] (1). Cloning of partial exons and 3′-flanking sequences of Hsp70.1 gene

[0027] (1) Primer design:

[0028]Using the bovine Hsp70.1 gene cDNA (GenBank accession number: NM_174550.1) as an information probe, using the BLAST tool in NCBI to screen homologous sequences in the GenBank bovine Genomes database, the homology located on bovine chromosome 23 was obtained as 99% of Hsp70.1 genome sequence (GenBank accession number: AC_000180.1). Amplification primers were designed according to the Hsp70.1 genome sequence (P1 forward primer 5'CATCCTTATTACCAACTTGCGTG 3'; P2 reverse primer 5'CGGACAAGAAGAAGGTGCTG 3'). Taking 60 Chinese Holstein cows as the experimental group, the blood genome DNA of Chinese Holstein cows was extracted, and the obtained DNA was mixed to construct a DNA pool as a template to amplify part of the cow's Hsp70.1 gene fragment.

[0029] After PCR product purification and sequencing, and obtain the nucleotide sequence as shown in sequence table SEQ ID NO:...

Embodiment 2

[0052] The results of Hsp70.1 gene sequencing showed that there were 14 genotype combinations in the Hsp70.1 gene containing 7 SNP sites. Haploview software was used to construct the haplotype and calculate the haplotype frequency. Three haplotypes accounted for all 91.8% of the loci are: haplotype 1-TATTACG- (accounting for 35.8%), haplotype 2-CGGTGAA- (accounting for 29.7%) and haplotype 3-TAGCACG- (accounting for 26.3%). These 3 haplotypes constitute 6 common genotypes 11, 12, 13, 22, 23 and 33.

[0053] The test materials used for correlation analysis also used 600 individual Chinese Holstein dairy cows from four large-scale dairy farms in Huanggang City, Hubei Province. The traits analyzed are mainly heat-resistant traits. Thermotolerance traits include rectal temperature, respiratory rate, erythrocyte potassium concentration, erythrocyte Na + K + ATPase (NKA) activity and milk production decline rate.

[0054] SAS (Windows version V8) software was used for statistica...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention belongs to the technical field of preparation of animal molecular markers and particularly relates to a molecular marker related to a heat-proof character of a cow, and application. According to the invention, a gene segment related to the heat-proof character of the cow and shown in a sequence table SEQ ID:1 is obtained through cloning, the sequence length is 426 bp, and an allelic mutant respectively exists in the position 54th, the position 80th, the position 197th, the position 383rd, the position 130th and the position 359th of the sequence; seven polymorphic sites are obtained in the invention. The cloned molecular marker can be applied to association analysis of the heat-proof character of the cow.

Description

technical field [0001] The invention belongs to the technical field of animal molecular markers, and in particular relates to a molecular marker related to the heat-resistant traits of dairy cows, and the heat-resistant traits are related to the heat-resistant stress response traits of dairy cows. Background technique [0002] For a long time, heat stress has been a common problem affecting the production of dairy cows in southern my country. Every year, heat stress reduces the milk production of dairy cows by more than 100,000 tons, seriously affecting the development of my country's dairy industry and causing huge economic losses. The heat stress of dairy cows is the result of the combined effects of environment and genetics. At present, the production of dairy cows mostly adopts nutritional regulation, supplemented by comprehensive measures of environmental improvement. The heat stress of dairy cows can be improved to a certain extent through environmental improvement and...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/11C12N15/10C12Q1/68
Inventor 熊琪陈明新刘洋索效军张年李晓锋
Owner INST OF ANIMAL SCI & VETERINARY HUBEI ACADEMY OF AGRI SCI