Molecular marker related to heat-proof character of cow, and application
A technology of molecular markers and heat-resistant traits, applied in the field of molecular markers and applications, can solve problems such as ineffectiveness, uncertain genetic potential of traits, and large influence
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0026] (1). Cloning of partial exons and 3′-flanking sequences of Hsp70.1 gene
[0027] (1) Primer design:
[0028]Using the bovine Hsp70.1 gene cDNA (GenBank accession number: NM_174550.1) as an information probe, using the BLAST tool in NCBI to screen homologous sequences in the GenBank bovine Genomes database, the homology located on bovine chromosome 23 was obtained as 99% of Hsp70.1 genome sequence (GenBank accession number: AC_000180.1). Amplification primers were designed according to the Hsp70.1 genome sequence (P1 forward primer 5'CATCCTTATTACCAACTTGCGTG 3'; P2 reverse primer 5'CGGACAAGAAGAAGGTGCTG 3'). Taking 60 Chinese Holstein cows as the experimental group, the blood genome DNA of Chinese Holstein cows was extracted, and the obtained DNA was mixed to construct a DNA pool as a template to amplify part of the cow's Hsp70.1 gene fragment.
[0029] After PCR product purification and sequencing, and obtain the nucleotide sequence as shown in sequence table SEQ ID NO:...
Embodiment 2
[0052] The results of Hsp70.1 gene sequencing showed that there were 14 genotype combinations in the Hsp70.1 gene containing 7 SNP sites. Haploview software was used to construct the haplotype and calculate the haplotype frequency. Three haplotypes accounted for all 91.8% of the loci are: haplotype 1-TATTACG- (accounting for 35.8%), haplotype 2-CGGTGAA- (accounting for 29.7%) and haplotype 3-TAGCACG- (accounting for 26.3%). These 3 haplotypes constitute 6 common genotypes 11, 12, 13, 22, 23 and 33.
[0053] The test materials used for correlation analysis also used 600 individual Chinese Holstein dairy cows from four large-scale dairy farms in Huanggang City, Hubei Province. The traits analyzed are mainly heat-resistant traits. Thermotolerance traits include rectal temperature, respiratory rate, erythrocyte potassium concentration, erythrocyte Na + K + ATPase (NKA) activity and milk production decline rate.
[0054] SAS (Windows version V8) software was used for statistica...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 