Streptomycete constitutive promoter and applications thereof
A technology of promoters and recombinant bacteria, applied in bacteria, recombinant DNA technology, and the use of vectors to introduce foreign genetic material, etc., can solve the problems of metabolic engineering and synthetic biology, and low activity of ermE*p
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0041] Embodiment 1, the acquisition of promoter kasO*p
[0042] 1. Transformation into a constitutive promoter
[0043] The kasO promoter (kasOp) is truncated, and the nucleotide sequence of kasOp is as follows figure 1 A, Previous studies have shown that the kasO gene is subject to strict temporal regulation, in which the protein ScbR can bind to the OA position and the OB position to inhibit it, and the protein ScbR2 can bind to the OB position to inhibit it. These two proteins control the high-level transcription of the kasO gene only in the logarithmic phase;
[0044] To transform the promoter kasOp into a constitutive promoter, four truncated kasOp1, kasOp2, kasOp3 and kasOp4 were first amplified by PCR to remove the ScbR2 binding site ( figure 1 B), then connect the lux reporter gene to transcribe DH5a, the analysis shows that the transcriptional activity of only 97bp kasOp3 is nearly 2 orders of magnitude higher than that of the original kasOp ( figure 1 C). Furthe...
Embodiment 2
[0063] Embodiment 2, the application of promoter kasO*p
[0064] 1. Functional identification of the promoter kasO*p
[0065] 1. Construction of recombinant plasmids and recombinant bacteria
[0066] kasO*p and ermE*p connect the chromogenic reporter gene xylE and the Kana resistance gene neo (same as Figure 4 ),details as follows:
[0067] Using sequence 1 (which can be artificially synthesized, kasO*p) as a template, use kasO*p primers (sequence kasO*p-F: ACGTCTCGAGTGTTCACATTCGA (sequence 4); kasO*p-R: ACGTACTAGTAACTCCCCCCAGTCCTG (sequence 5)) to amplify to obtain a PCR product, The PCR product was digested with BamHI and SpeI, and the resulting digested product was combined with the vector pDR4 (the vector pDR4 was derived from the vector pDR2, and the vector pDR4 was inserted into the BamHI and SpeI sites at the NotI site of the vector pDR2. pDR2 was described in Xiang SH, Li J, Yin H, Zheng JT, Yang X, Wang HB, Luo JL, Bai H, Yang KQ: Application of a double-reporter-...
PUM

Abstract
Description
Claims
Application Information

- Generate Ideas
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com