Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Streptomycete constitutive promoter and applications thereof

A technology of promoters and recombinant bacteria, applied in bacteria, recombinant DNA technology, and the use of vectors to introduce foreign genetic material, etc., can solve the problems of metabolic engineering and synthetic biology, and low activity of ermE*p

Inactive Publication Date: 2013-12-04
INST OF MICROBIOLOGY - CHINESE ACAD OF SCI
View PDF1 Cites 11 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0003] In Streptomyces, regardless of engineering applications or theoretical research, the constitutive promoter is currently only the erythromycin promoter ermE*p, which is widely recognized and widely used, which is far from meeting the needs of systematic metabolic engineering and synthetic biology. , and studies have shown that ermE*p activity is not high in some Streptomyces

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Streptomycete constitutive promoter and applications thereof
  • Streptomycete constitutive promoter and applications thereof
  • Streptomycete constitutive promoter and applications thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0041] Embodiment 1, the acquisition of promoter kasO*p

[0042] 1. Transformation into a constitutive promoter

[0043] The kasO promoter (kasOp) is truncated, and the nucleotide sequence of kasOp is as follows figure 1 A, Previous studies have shown that the kasO gene is subject to strict temporal regulation, in which the protein ScbR can bind to the OA position and the OB position to inhibit it, and the protein ScbR2 can bind to the OB position to inhibit it. These two proteins control the high-level transcription of the kasO gene only in the logarithmic phase;

[0044] To transform the promoter kasOp into a constitutive promoter, four truncated kasOp1, kasOp2, kasOp3 and kasOp4 were first amplified by PCR to remove the ScbR2 binding site ( figure 1 B), then connect the lux reporter gene to transcribe DH5a, the analysis shows that the transcriptional activity of only 97bp kasOp3 is nearly 2 orders of magnitude higher than that of the original kasOp ( figure 1 C). Furthe...

Embodiment 2

[0063] Embodiment 2, the application of promoter kasO*p

[0064] 1. Functional identification of the promoter kasO*p

[0065] 1. Construction of recombinant plasmids and recombinant bacteria

[0066] kasO*p and ermE*p connect the chromogenic reporter gene xylE and the Kana resistance gene neo (same as Figure 4 ),details as follows:

[0067] Using sequence 1 (which can be artificially synthesized, kasO*p) as a template, use kasO*p primers (sequence kasO*p-F: ACGTCTCGAGTGTTCACATTCGA (sequence 4); kasO*p-R: ACGTACTAGTAACTCCCCCCAGTCCTG (sequence 5)) to amplify to obtain a PCR product, The PCR product was digested with BamHI and SpeI, and the resulting digested product was combined with the vector pDR4 (the vector pDR4 was derived from the vector pDR2, and the vector pDR4 was inserted into the BamHI and SpeI sites at the NotI site of the vector pDR2. pDR2 was described in Xiang SH, Li J, Yin H, Zheng JT, Yang X, Wang HB, Luo JL, Bai H, Yang KQ: Application of a double-reporter-...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a streptomycete constitutive promoter and applications thereof, and provides an DNA fragment. The DNA fragment is any one selected from the following DNA molecules in 1)-3): 1) an DNA molecule represented by the sequence 1 in a sequence table; 2) an DNA molecule with promoter functions and hybrid with the DNA molecule shown in 1) under strict conditions; 3) an DNA molecule with more than 90% of homology with the DNA molecule shown in 1) and with promoter functions. The experiments shows that a strong constitutive promoter kasO*p is screened out, and the promoter and the erythromycin promoter ermE*p are compared in representation of transcriptional level and expression level in streptomyces coelicolor, streptomyces avermitilis and streptomyces venezuelae, and the results show that the modified promoter kasO*p is better than the the erythromycin promoter ermE*p.

Description

technical field [0001] The invention relates to the field of biotechnology, in particular to a streptomyces constitutive promoter and its application. Background technique [0002] Streptomyces can produce a variety of secondary metabolites. These metabolites can not only be used as medicine for the human body and as an additive for livestock feed, but also for plant protection in crop production. Streptomyces is the main group of antibiotic-producing bacteria, and it produces more than 60% of the known antibiotics, including many clinically important antibiotics. The topic of altering the metabolic pathways of bacterial species to improve specific target products or to confer new phenotypic characteristics is old and dynamic. Over the course of nearly a century, the strain transformation of antibiotic-producing bacteria has gone through the stage of traditional strain transformation by means of mutagenesis breeding, and the period of rational transformation based on metabo...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/113C12N15/63C12N5/10C12N1/21C12N15/11C12N15/76C12P17/16C12R1/465
Inventor 杨克迁王为善李肖王娟
Owner INST OF MICROBIOLOGY - CHINESE ACAD OF SCI
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com