Construction and application of vector used for developing high-expression cell strain

A eukaryotic expression vector and vector technology, which can be applied in the direction of using vectors to introduce foreign genetic material, cells modified by the introduction of foreign genetic material, and recombinant DNA technology. The effect of overcoming the position effect and improving the efficiency

Active Publication Date: 2014-01-22
BEIJING DONGFANG BIOTECH
View PDF8 Cites 9 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0011] In addition, it has been reported in the literature that a 72bp repeat sequence in the SV40 promoter is deleted, or after deleting a 72bp repeat sequence, at the 5th position of the remaining 72bp repeat sequence The introduction of the TGG-GTT mu

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Construction and application of vector used for developing high-expression cell strain
  • Construction and application of vector used for developing high-expression cell strain
  • Construction and application of vector used for developing high-expression cell strain

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0051] Example 1: Construction of the pTSE-w vector and verification of the validity of the WPRE sequence

[0052] 1, Construction of pTSE-w vector:

[0053]The WPRE sequence is shown as SEQ IN NO: 3, which was synthesized by Shanghai Jierui Bioengineering Co., Ltd. Design PCR primers for amplification, and then digest with BamHI and BglII to obtain the target fragment.

[0054] P1: 5'-TAG GGATCC AATCAACCTCTGGA-3'

[0055] P2: 5'-TGT AGATCT CGAAGACGCGGAAGAGGCCG-3'

[0056] Use BamHI to linearize the pTSE vector and dephosphorylate it to prevent the vector from self-ligating; because BamHI and BglII are homologous enzymes, the sticky ends generated can be ligated, and finally pick the pTSE-w vector whose WPRE insertion direction is forward (we It is specified that the same insertion direction as PCMV-MCS-RBGpolyA is forward). At this time, the BamHI site of the original multiple cloning site is retained, and after the WPRE sequence is connected, the downstream restr...

Embodiment 2

[0067] Embodiment 2: Construction of pSNEO vector

[0068] Based on the pTSE-w vector, we constructed the vector pSNEO for screening stably transfected cell lines. The specific construction method is as follows: using PcDNA3.1 + The plasmid (purchased from Invitrogen) was used as a template, and the synthetic primer sequences were as follows (PNEOF-1 and PNEOR-2 synthesized 5' phosphorylated primers):

[0069] PNEOF-1: 5'-GCAGGCAGAAGTATGCAAAG-3'

[0070] PNEOR-1: 5'-GATGTCTACTGCATCCTCGATGTGATCAGATCCGAAAAT-3'

[0071] PNEOF-2: 5'-AGGATGCAGTAGACATCCTCGATGATTGAACAAGATGGAT-3'

[0072] PNEOR-2: 5'- GATATC GCT ACATGT ATACAGACATGATAAGATACATTGATG-3'

[0073] The part marked in the box is the reverse complementary sequence, the underlined part is the restriction site of EcoRV and PciI respectively, the fragment NEO1 is obtained by the amplification of PNEOF-1 and PNEOR-1, the fragment NEO2 is obtained by the amplification of PNEOF-2 and PNEOR-2, and the fragment NEO2 is obtain...

Embodiment 3

[0074] Example 3: Construction of pSGS vector and verification of high efficiency in cell line construction

[0075] 1. Construction of pSGS vector

[0076] Using the pSNEO vector and pBT-NESP-Fc vector (CN101870735A, the vector constructed in paragraphs 86-88 on page 9 of the instruction manual, which contains the GS gene, which was fully synthesized by Shanghai Jierui Bioengineering Co., Ltd.) as templates, the primer sequences were designed and synthesized as follows:

[0077] PGSF-1 : 5'-GAGG CCTAGG CTTTTGCAAAAAGCTCCCGGGAGCTTGTATATCC

[0078] ATTTTCGGATCTGATCAC -3'

[0079] PGSF-2:

[0080] 5’-ATTTTCGGATCTGATCACATCGAGGATGCAGTAGACATCCTCGA

[0081] TGGCCACCTC AGCAAGTTC-3'

[0082] PGSR-1: 5'-GTCTG TTCGAA TTAGTTTTTTGTATTGGAAGGGC-3'

[0083] The underlined parts are the restriction sites of AvrII and BstBI respectively, and the overlapping sequences are in the box; the amplified The PCR fragment, that is, the GS gene containing the hairpin structure sequen...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention relates to a pSGS vector and application of the vector to development of a high-expression cell strain. The construction of the vector comprises the following steps: based on a neomycin resistance screening gene NEO, through combined strategy of weakening screening gene expression and reinforcing target gene expression, constructing an expression vector pSNEO, and in view of the amplification function of a GS system, through designing a primer, replacing the hairpin structure sequence and the NEO gene of the vector pSNEO with a hairpin structure sequence and a GS gene to obtain a universal vector pSGS for screening a high-expression and stable-transfection cell strain. Through the pSGS vector constructured by the invention, the construction of a stable and high-expression cell strain of the target gene can be finished conveniently and quickly, and a new tool is provided for preparation of macromolecular recombinant protein.

Description

technical field [0001] The invention relates to the gene engineering expression technology of biopharmaceuticals, in particular to the construction and application of a vector used for the development of high-expression cell lines. Background technique [0002] The acquisition of high-efficiency mammalian cell expression system and high-expression engineered cell line is the bottleneck in the research and production of genetically engineered drugs, and expression vector and host cell are the two basic components of mammalian cell expression system. The expression systems currently used to prepare genetically engineered drugs include prokaryotic expression systems with Escherichia coli as the main host cell and eukaryotic expression systems with yeast, insect cells, plant cells and mammalian cells as hosts. [0003] The CHO expression system is one of the most widely used eukaryotic expression systems and one of the few animal cells that can be cultured in high-density suspen...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
IPC IPC(8): C12N15/85C12N15/64C12N15/66C12N5/10
Inventor 刘志刚孟艳敏王康高震郭晶晶彭博白先宏
Owner BEIJING DONGFANG BIOTECH
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap