Molecular marker tightly linked with main effective genetic locus embodying sesame dampness resistance and application thereof

A major gene and molecular marker technology, applied in the fields of molecular biology and genetic breeding, can solve the problems of narrow genetic basis, unavailability, and large differences in humidity tolerance, achieve clear selection goals, convenient and rapid detection, and improve selection efficiency. Effect
CN103525919AActive Publication Date: 2014-01-22INST OF OIL CROPS RES CHINESE ACAD OF AGRI SCI
2 Cites 12 Cited by

Patent Information

Authority / Receiving Office
CN · China
Current Assignee / Owner
INST OF OIL CROPS RES CHINESE ACAD OF AGRI SCI
Publication Date
2014-01-22

Smart Images

  • Figure 1
    Figure 1
  • Figure 2
    Figure 2
  • Figure 3
    Figure 3
Patent Text Reader

Abstract

The invention relates to a molecular marker tightly linked with a main effective genetic locus embodying sesame dampness resistance and application thereof. The main effective genetic locus qWHCHL09 is located on the 9th linkage group, and the molecular marker tightly linked with the main effective genetic locus is ZM428 whose sequences are as follows: ZM428F: AGGATGATGATGTGATGAGAG (5'-3') and ZM428R: CTGCTACTCCTTTTGTCTCTG (5'-3'). The molecular marker is obtained by hybridizing sesame 13 in sesame dampness-resistant varieties and a sensitive germplasm Yiyangbai to obtain F6-generation segregation population, namely a recombinant inbred line (RIL) population, and performing molecular genetic linkage analysis on the F6-generation segregation population. The molecular marker tightly linked with the main effective genetic locus embodying the sesame dampness resistance is applied to breeding of the sesame dampness-resistant varieties and screening of dampness-resistant traits of the sesame germplasm as well as early prediction; the auxiliary dampness resistance choosing target is clear; and the cost is relatively low.
Need to check novelty before this filing date? Find Prior Art

Description

technical field

[0001] The invention belongs to the technical field of molecular biology and genetic breeding, and in particular relates to a main effect gene locus of moisture resistance traits of sesame, its closely linked molecular markers and applications thereof. Background technique

[0002] Sesamum (Sesamum indicum L.) is a traditional characteristic oil crop in my country. It is planted all over the country. It has high economic and nutritional value. It is not only loved by people, but also widely used in food, medicine and other industries. my country is one of the main sesame producing countries in the world, with the yield per unit area ranking first in the world and the total output accounting for one-fifth of the world. In recent years, the domestic demand for sesame has increased year by year, reaching one million tons, and the import volume ranks first in the world, reaching about 400,000 tons for three consecutive years. However, the total supply of domestic...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More