Molecular marker tightly linked with main effective genetic locus embodying sesame dampness resistance and application thereof

A major gene and molecular marker technology, applied in the fields of molecular biology and genetic breeding, can solve the problems of narrow genetic basis, unavailability, and large differences in humidity tolerance, achieve clear selection goals, convenient and rapid detection, and improve selection efficiency. Effect

Active Publication Date: 2014-01-22
INST OF OIL CROPS RES CHINESE ACAD OF AGRI SCI
View PDF2 Cites 12 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Since the 1970s, sesame breeders in my country have taken improving the moisture resistance of varieties as one of the main breeding goals. Through identification, it has been found that the moisture resistance of sesame materials with different genetic backgrounds varies greatly, and the resources with strong moisture resistance Using techniques such as hybridization for parents can improve the moisture resistance of varieties to a certain extent, but no breakthrough has been made so far, and it is still a "bottleneck" problem restricting the development of sesame production in my country
The main problems in the research are: 1) Lack of excellent genetic resources for high humidity tolerance, and narrow genetic basis; 2) Conventional field selection methods for moisture tolerance phenotypes are heavy workload and easily affected by the environment, and breeders basically do not use them, which limits moisture tolerance The pace of breeding; 3) There is a lack of effective markers and efficient and accurate selection techniques that can be used for molecular assisted selection of moisture tolerance; 4) The mining of moisture tolerance functional genes is seriously lagging behind, and it is impossible to use advanced genetic engineering breeding to improve the moisture tolerance of sesame
However, there is no research report on the mapping of sesame moisture tolerance genes at home and abroad.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Molecular marker tightly linked with main effective genetic locus embodying sesame dampness resistance and application thereof
  • Molecular marker tightly linked with main effective genetic locus embodying sesame dampness resistance and application thereof
  • Molecular marker tightly linked with main effective genetic locus embodying sesame dampness resistance and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0038] Example 1 Excavation of main effect gene loci of sesame moisture resistance traits

[0039] (1) Construct a moisture-tolerant / sensitive sesame recombinant inbred line (RIL) population and identify moisture tolerance

[0040] F1 seeds were obtained by crossing the moisture-resistant sesame variety Zhongzhi 13 (84% surviving plant rate after wet damage) and the sensitive germplasm Yiyangbai (31% surviving plant rate after wet damage), and the F1 plants were self-crossed to produce F2 generation seeds. The F2 plants are self-crossed to produce the seeds of the F3 generation, and the F3 generation is planted in rows and self-crossed to produce seeds. Only one seed of a single plant is harvested in each row, and it is planted to become a row of the next generation, and so on, and finally Obtain the F6 generation segregation population, that is, the recombinant inbred line (RIL) population;

[0041] Identify the moisture resistance of the parents and RIL strains at the full ...

Embodiment 2

[0071] Example 2 Application of the Molecular Marker ZM428 Tightly Linked to the Main Effect Gene Locus qWHCHL09 in Sesame Humidity-tolerant Breeding

[0072]After crossing Zhongzhi 13 with another sensitive variety Zhongzhi 7, 265 F2 individual plants were obtained. In addition, because the moisture resistance of F2 individual plants cannot be identified, 265 F2 individual plants were planted to obtain the corresponding 265 F2: 3 families, F2: The moisture resistance of the 3 families represents the moisture resistance of the F2 single plant. Molecular identification of F2 individual plants at the seedling stage, the specific steps include the extraction of total leaf DNA (specifically as the DNA extraction method in Example 1) and molecular identification using the molecular marker ZM428 closely linked to the major moisture resistance gene locus qWHCHL09, That is, through PCR amplification, polyacrylamide gel electrophoresis test and band type statistics (specifically as PCR...

Embodiment 3

[0076] Example 3 Application of the Molecular Marker ZM428 Tightly Linked to the Main Gene Locus qWHCHL09 in the Screening and Early Prediction of Sesame Germplasm Resources for Moisture Tolerance

[0077] Plant 186 copies of sesame core germplasm resources, extract the DNA of each material at the seedling stage (specifically, the DNA extraction method in Example 1), and use the molecular marker ZM428 closely linked to the main moisture resistance gene locus qWHCHL09 for molecular identification, that is, by PCR Amplification, polyacrylamide gel electrophoresis test and band type statistics (specifically as the PCR amplification, gel electrophoresis and band type statistical method in embodiment 1), and carry out moisture resistance to 186 parts of sesame germplasm resources in full flowering stage The identification results showed that among the core germplasm resources of sesame obtained through molecular marker-assisted selection, 62% of the resources survived plant rates af...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to a molecular marker tightly linked with a main effective genetic locus embodying sesame dampness resistance and application thereof. The main effective genetic locus qWHCHL09 is located on the 9th linkage group, and the molecular marker tightly linked with the main effective genetic locus is ZM428 whose sequences are as follows: ZM428F: AGGATGATGATGTGATGAGAG (5'-3') and ZM428R: CTGCTACTCCTTTTGTCTCTG (5'-3'). The molecular marker is obtained by hybridizing sesame 13 in sesame dampness-resistant varieties and a sensitive germplasm Yiyangbai to obtain F6-generation segregation population, namely a recombinant inbred line (RIL) population, and performing molecular genetic linkage analysis on the F6-generation segregation population. The molecular marker tightly linked with the main effective genetic locus embodying the sesame dampness resistance is applied to breeding of the sesame dampness-resistant varieties and screening of dampness-resistant traits of the sesame germplasm as well as early prediction; the auxiliary dampness resistance choosing target is clear; and the cost is relatively low.

Description

technical field [0001] The invention belongs to the technical field of molecular biology and genetic breeding, and in particular relates to a main effect gene locus of moisture resistance traits of sesame, its closely linked molecular markers and applications thereof. Background technique [0002] Sesamum (Sesamum indicum L.) is a traditional characteristic oil crop in my country. It is planted all over the country. It has high economic and nutritional value. It is not only loved by people, but also widely used in food, medicine and other industries. my country is one of the main sesame producing countries in the world, with the yield per unit area ranking first in the world and the total output accounting for one-fifth of the world. In recent years, the domestic demand for sesame has increased year by year, reaching one million tons, and the import volume ranks first in the world, reaching about 400,000 tons for three consecutive years. However, the total supply of domestic...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12Q1/68C12N15/11A01H1/02
CPCC12Q1/6895C12Q2600/13
Inventor张秀荣张艳欣王林海黎冬华高媛
OwnerINST OF OIL CROPS RES CHINESE ACAD OF AGRI SCI