Unlock instant, AI-driven research and patent intelligence for your innovation.

A large yellow croaker tropomyosin gene and its recombinant protein and application

A tropomyosin and recombinant protein technology, which is applied to the large yellow croaker tropomyosin gene and its recombinant protein and application fields, can solve the problems such as the lack of large yellow croaker tropomyosin, and achieves good application prospects and wide application value. Effect

Inactive Publication Date: 2016-06-08
JIMEI UNIV
View PDF1 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, there is no report on the sequence of large yellow croaker tropomyosin (Tropmyosin)

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • A large yellow croaker tropomyosin gene and its recombinant protein and application
  • A large yellow croaker tropomyosin gene and its recombinant protein and application
  • A large yellow croaker tropomyosin gene and its recombinant protein and application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0037] A cloned large yellow croaker tropomyosin (Tropmyosin) gene in this embodiment has the base sequence of SEQ ID NO.1 in the sequence listing.

[0038] (1) Information of SEQIDNO1 (see sequence listing)

[0039] 1TGGCGGCCTTCGCGTCCATAGACTCCGTACGAAGGAAAATTCAAACACTGCAGCAAGTGG

[0040] 61CGTACGAGGCTGAGGACCGAGCCGCGCTGCTGCAGGGGGAGGCGGACATGGAGGCCATCA

[0041] 121AGAAGAAGATGCAGATGCTGAAGCTGGACAAGGAGAACGCCATCGACAGGGCAGAGCAGG

[0042] 181CTGAGTGCGACCAGAAGGCGGCCGAGGATAAATGCAAGCTGTTGGAGGATGAGCTGCTGG

[0043] 241CTCTGCAGAAGAAGCTGAAGGGAACAGAGGATGAGCTTGACAAGTACTCGGAGGCCCTGA

[0044]301AGGACGCTCAGGAGAAACTGGAACTGTCTGAGAAGAAGGCCGCAGATGCCGAGGGCGATG

[0045] 361TGGCGTCTTTGAACCGCAGGATCCAGTTGGTGGAGGAGGAGTTGGACCGCGCTCAGGAGA

[0046] 421GACTGGCCACAGCCCTGCAGAAGCTGGAGGAGGCCGAGAAGGCTGCAGATGAGAGCGAAA

[0047] 481GAGGCATGAAGGTGATCGAGAACAGAGCCATGAAAGATGAGGAGAAGATGGAGATCCAAG

[0048] 541AGATGCAGCTGAAGGAGGCCAAACACATTGCTGAGGAGGCCGACCGCAAATATGAAGAGG

[0049] 601TTGCACGTAAACTGGTGATCCTAGAGGGAGATCTGGA...

Embodiment 2

[0135] This example uses the large yellow croaker tropomyosin gene obtained by the cloning method in Example 1, which has the function of improving the disease resistance of large yellow croaker.

[0136] First, according to the analysis of the multiple cloning site of the prokaryotic expression vector pGEX-4T-2 (preserved by the laboratory) and the enzyme cutting site in the ORF of the large yellow croaker tropomyosin (Tropmyosin) gene, the large yellow croaker tropomyosin (Tropmyosin) ) gene clone inserted between the EcoRI and XhoI restriction sites of the expression vector. Upstream primer F4 used for cloning the ORF of the large yellow croaker tropomyosin (Tropmyosin) gene: 5' CGGAATTCATGGAGGCCATCAAGAAG 3' (italics indicate the restriction site of EcoRI), downstream primer R4: CCGCTCGAGCTACAGAGTAGTCATGTC 3' (italics indicate the restriction site of XhoI).

[0137] The PCR reaction system for amplifying Tropmyosin gene fragments is: 10×Taq buffer 2 μL, dNTP 1.6 μL, for...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
molecular weightaaaaaaaaaa
Login to View More

Abstract

The invention relates to a large yellow croaker tropomyosin gene, its recombinant protein and its application, and relates to a kind of tropomyosin. The protein gene has the NO.1 gene sequence, and the GST recombinant protein has the NO.2 amino acid sequence. The preparation of the recombinant protein: use 2 specific primers to amplify the open reading frame of the tropomyosin gene; insert the expression vector pGEX-4T-2 between the EcoRI and XhoI multiple cloning sites; the constructed recombinant expression vector pGEX-4T-2-Tropmyosin was transferred into the expression strain BL21(DE3) for IPTG-induced expression; the GST-Tropmyosin fusion protein was purified by Glutathione Sepharose4B affinity chromatography . It can be used in the preparation of drugs for improving the disease resistance of large yellow croakers.

Description

technical field [0001] The present invention relates to a kind of tropomyosin (Tropmyosin), especially relates to a large yellow croaker tropomyosin gene and its recombinant protein and application. Background technique [0002] Large yellow croaker is the fish with the largest amount of seawater cage culture in my country. It is known as the "seawater national fish", with an annual output of 80,000 tons and an annual output value of more than 4 billion yuan. However, the cultivation of large yellow croaker is currently seriously threatened by various diseases. The control of diseases of large yellow croaker mainly relies on chemical drugs and antibiotics, which has resulted in increased drug resistance of pathogenic bacteria, drug residues in farmed products, environmental pollution and blocked exports. And so on a series of questions. [0003] Tropmyosin (Tropmyosin) is a skeleton protein discovered in 1948. It is a fibrous protein composed of α-helical structure and coil...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12N15/12C12N15/10C07K14/435A61K48/00A61P31/00
Inventor 韩芳王志勇
Owner JIMEI UNIV