Method, kit, primers and probes for detecting relative expression of rrm1 mRNA
A relative expression and kit technology, applied in the field of life science and biology, can solve the problems of high cost and poor specificity, and achieve the effect of reducing detection cost, simple operation and high detection accuracy.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0048] A nucleic acid detection kit for quantitatively detecting the relative expression of RRM1mRNA in a sample, including:
[0049] Red blood cell lysate (TIANGEN)
[0050] Sample RNA extraction solution: QIAGEN RNeasy FFPE Kit;
[0051] Detection system PCR reaction solution: THUNDERBIRD Probe qPCR Mix (2×), RRM1 upstream primer (RRM1-F), downstream primer (RRM1-R) 0.8 μM each, probe (RRM1-probe) 0.4 μM; housekeeping gene actin upstream Primer (Actin-F), downstream primer (Actin-R) each 0.8 μM, probe (Actin-probe) 0.4 μM; among them,
[0052] RRM1-F: GATTTCTCTTACAATTACTTC
[0053] RRM1-R:GCCACTTTTCCATTGATCT
[0054] RRM1-Probe: FAM-CTTTAAGACGCTAGAGCGGTCTTATTT-TAMRA
[0055] Actin-F: TGAGCGAGGCTACAGCTT
[0056] Actin-R: TCCTTGATGTCGCGCACGATTT
[0057] Actin-Probe: FAM-ACCACCACGGCCGAGCGG-TAMRA;
[0058] Positive control substance: solution containing RRM1 gene;
[0059] Negative control substance: solution without RRM1 gene;
[0060] Blank control substance: normal s...
Embodiment 2
[0062] The using method of kit of the present invention:
[0063] (1) Extract tissue RNA from paraffin sections: cut out the tissue or paraffin section samples and put them in a 1.5ml centrifuge tube (scrape); add 1ml of tissue clear solution, shake and mix, and centrifuge at 13000rpm for 1min; remove the supernatant and add 500ml of tissue For transparent liquid, shake and mix and centrifuge at 13,000rpm for 1min; remove the supernatant, add 1ml of absolute ethanol, shake and mix, and centrifuge at 13,000rpm for 1min; remove the supernatant and put it in a metal bath at 37°C for 10min (open the cover) until the liquid is dry; refer to QIAGEN RNeasy FFPE Kit paraffin RNA extraction kit manual, extract sample RNA.
[0064] (2) Refer to the instruction manual of the Rever Tra Ace qPCR RT Kit kit from TOYOBO, and reverse-transcribe the sample RNA extracted in (1) into cDNA.
[0065] (3) Reagent configuration: according to the number of people to be tested, X ul of the PCR reacti...
Embodiment 3
[0075] Using the nucleic acid detection method of the present invention to detect clinical samples
[0076] Take 20 cases of paraffin section samples of non-small cell lung cancer (NSCLC) patients submitted for inspection, extract tissue RNA, prepare reagents and detect according to the method described in Example 2.
[0077] For each sample, 2ul of cDNA generated by reverse transcription was taken and added to the PCR reaction solution of the detection system. At the same time, do positive, negative, and blank control experiments, and a standard curve for the housekeeping gene / target gene. A 96-well fluorescent PCR instrument can detect 20 samples at the same time, each sample is repeated twice, a positive control, a negative control and a blank control. The detection time is only 100 minutes.
[0078] The experimental results are compared with the reported results of the immunohistochemical test to determine the accuracy of the sample detection. Some positive results are ...
PUM
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap