Method for isolating high-purity circulating tumor cells from blood

A tumor cell, high-purity technology, applied in the field of biological and medical detection, can solve the problems of time-consuming and labor-intensive, non-specific adsorption, low purity of circulating tumor cells, etc., and achieve the effect of high cutting efficiency, simple operation and large exposure area.

Active Publication Date: 2016-08-17
SHANGHAI JIAO TONG UNIV
View PDF4 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0005] However, in addition to the capture efficiency of these methods still needs to be improved, there is also a serious problem of non-specific adsorption. Even if the red blood cells in the blood are removed by lysis, centrifugation or other microfluidic chip technology methods, the remaining white blood cells will still be in large quantities. The non-specific adsorption of leukocytes on the capture surface leads to low purity of circulating tumor cells in the captured cells. It is necessary to distinguish the non-specifically adsorbed leukocytes from circulating tumor cells one by one by later immunostaining, which takes a lot of time and manpower, and It is easy to be interfered by false-positive or false-negative staining results and lead to misjudgment, thereby affecting the detection results and the prognosis of cancer based on them

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for isolating high-purity circulating tumor cells from blood

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0041] Example 1 Release of Circulating Tumor Cells by Photosensitive Group and Ultraviolet Light Irradiation

[0042] M: AAAAAAAAAAGTCGAGGATTCTGAACCTGT;

[0043] M'-PC-NH 2 :

[0044] 5'-NH 2 - AAAAA-PCspacer-AAAAAACAGGTTCAGAATCCTCGAC-3';

[0045] M'-5PC-NH 2 :

[0046] 5, -NH 2 -PCspacer-AAAAAAAAAAACAGGTTCAGAATCCTCGAC-3'.

[0047] Wherein M is the polynucleotide loaded on the inner surface of the microchannel (see SEQ ID NO.1), M'-PC-NH- 2 (see SEQ ID NO.4) and M'-5PC-NH 2 (See SEQ ID NO.5) is a labeled single-stranded polynucleotide linked to the antibody, which can specifically bind to M. The PC spacer is a photosensitive group, which can be broken under the irradiation of a certain wavelength of light, preferably with a wavelength of 365 nanometers. M'-PC-NH 2 With M'-5PC-NH 2 The difference is that the photosensitive group is directly connected to the 5-terminal antibody, and is separated from the 5-terminal antibody by several nucleotide molecules. These po...

Embodiment 2

[0053] Example 2 Release of Circulating Tumor Cells by Restriction Endonucleases

[0054] A-EcoR1 (see SEQ ID NO.2): 5'-AAAAAAAAAAAAGAGCTAAGTCCGTAGAATTCAAAAAAAAAAGAGCTAAGTCCGTAGAATTCAAAAAAAAAAAAAA-3';

[0055] A-EcoRI′-NH 2 (see SEQ ID NO.6):

[0056] 5'-NH 2 -AAAAAAAAAAGAATTCTACGGACTTAGCTCCAGGAT-3';

[0057] B-BanHI (see SEQ ID NO.3): 5'-AAAAAAAAAAAATTGAATCATGCCTAGGATCCAAAAAAAAAATTGAATCATGCCTAGGATCCAAAAAAAAAAAAA-3';

[0058] B-BamHI′-NH 2 : (see SEQ ID NO.7) 5'-NH 2 -AAAAAAAAAAAGGATCCTAGGCATGATTCAATGAGGC-3';

[0059] Wherein A-EcoRI and B-BamHI are polynucleotides loaded on the inner surface of the microchannel, and A-EcoRI'-NH 2 with B-BamHI′NH 2 It is a labeled single-stranded polynucleotide linked to an antibody. A-EcoRI and A-EcoRI′-NH 2 There is a sequence that can be cut by the restriction endonuclease EcoRI, B-BamHI and B-BamHI'-NH 2 There is a sequence that can be cleaved by the restriction endonuclease BamHI in .

[0060] The capture method of tumor cells...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
purityaaaaaaaaaa
Login to View More

Abstract

The invention discloses a method for separating high-purity circulating tumor cells from blood. The method includes the following steps: A. Loading single-stranded polynucleotides on the surface of the microchannel of a microfluidic chip, and combining the polynucleotides with antibodies ‑The labeled single-stranded polynucleotide in the labeled single-stranded polynucleotide complex specifically binds to load the antibody on the surface of the microchannel; B, contact the blood sample with the antibody loaded on the surface of the microchannel of the microfluidic chip, and through the antibody and The binding of specific antigens on the surface of circulating tumor cells in the blood separates circulating tumor cells from the blood; C. The antibody and the circulating tumor cells captured by it are released from the surface of the microchannel by cutting off the polynucleotide chain, so that the separation is highly effective Pure circulating tumor cells. The method of the invention can separate circulating tumor cells with higher purity. If the released cells are subjected to a negative selection chip for leukocytes, circulating tumor cells with extremely high purity can be obtained.

Description

technical field [0001] The invention relates to biological and medical detection, and relates to a method for isolating high-purity rare cells from mixed cell populations, in particular to a method for isolating high-purity circulating tumor cells from blood. Background technique [0002] Rare cells refer to cells that are rare in biological samples but have important biological functions or clinical detection significance, such as circulating tumor cells in human peripheral blood, circulating endothelial cells, cells infected by viruses, and tumors in solid tumors stem cells, etc. Due to the extremely rare number of rare cells, its detection is like finding a needle in a haystack, and its further analysis is more difficult. Therefore, it is urgent to develop methods and tools that can efficiently and quickly separate rare cells from complex biological samples. [0003] Circulating tumor cells (CTCs) in human peripheral blood are a representative type of rare cells, which r...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityPatents(China)
IPC IPC(8): C12N5/09
Inventor施奇惠邓宇亮孙帅张瑜
OwnerSHANGHAI JIAO TONG UNIV