Unlock instant, AI-driven research and patent intelligence for your innovation.

dsRNA (double-stranded ribonucleic acid) for inhibiting expression of wheat aphid cytochrome c oxidase viic subunit gene and application thereof

A cytochrome and gene technology, applied in the field of dsRNA, can solve the problem of decreased expression of target genes

Active Publication Date: 2014-03-26
INST OF CROP SCI CHINESE ACAD OF AGRI SCI
View PDF2 Cites 8 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

The process of RNAi is that double-stranded RNA (dsRNA) enters the organism and is cut into 21-23nt siRNA by Dicer enzyme. The siRNA binds to the RNA-induced silencing complex, binds to the target mRNA of complementary sequence, and is recognized by Dicer, resulting in the expression of the target gene decline in volume

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • dsRNA (double-stranded ribonucleic acid) for inhibiting expression of wheat aphid cytochrome c oxidase viic subunit gene and application thereof
  • dsRNA (double-stranded ribonucleic acid) for inhibiting expression of wheat aphid cytochrome c oxidase viic subunit gene and application thereof
  • dsRNA (double-stranded ribonucleic acid) for inhibiting expression of wheat aphid cytochrome c oxidase viic subunit gene and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0021] Example 1. Preparation of dsRNA for Silencing Cytochrome C Oxidase VIIc Subunit Gene

[0022] 1. Extract the total RNA of Aphid rubella and reverse transcribe it into cDNA.

[0023] 2. Using the cDNA obtained in step 1 as a template, perform PCR amplification with a primer pair composed of P1-F and P1-R to obtain a PCR amplification product. The agarose gel electrophoresis of the PCR amplification product is shown in figure 1 a.

[0024] P1-F (upstream primer): TAATACGACTCACTATAGGG AG TGGTTCAAAAGCCGTACAAGCGT;

[0025] P1-R (downstream primer): TAATACGACTCACTATAGGG AG GGAAGACCAAAACCGGTGCTAAAGA.

[0026] The underlined region is the T7 promoter sequence.

[0027] PCR reaction system: 10×PCR Buffer 5μL, dNTP (2.5mmol L -1 ) 4 μL, rTaq 0.5 μL, upstream primer (20 μmol L -1 ) 1 μL, downstream primer (20 μmol L -1 ) 1 μL, template 1 μL, with ddH 2 O to make up to 50 μL.

[0028] PCR reaction conditions: 94°C for 4min; 39 cycles of 94°C for 30s, 55°C for 30s, and...

Embodiment 2

[0032] Embodiment 2, preparation of dsRNA for silencing GFP gene

[0033] 1. Synthesize the double-stranded DNA molecule shown in sequence 3 of the sequence listing.

[0034] 2. Using the double-stranded DNA molecule obtained in step 1 as a template, perform PCR amplification with a primer pair composed of P4-F and P4-R to obtain a PCR amplification product. The agarose gel electrophoresis of the PCR amplification product is shown in figure 1 b.

[0035] P4-F (upstream primer): TAATACGACTCACTATAGGG ACGGGAACTACAAGACACG;

[0036] P4-R (downstream primer): TAATACGACTCACTATAGGG C TTTGGAAAGGGCAGATT.

[0037] The PCR reaction system and PCR reaction conditions are the same as those in Step 2 of Example 1.

[0038] 3. Preparation of dsRNA-2

[0039] The PCR amplification product obtained in step 2 was recovered and used as a template, and the T7 in vitro transcription kit was used for in vitro transcription (incubated at 42°C for 16 hours), and the residual template DNA and s...

Embodiment 3

[0041] Embodiment 3, the application of dsRNA in inhibiting the growth of aphids

[0042] 1. Preparation of artificial diet for aphids and preparation of feeder

[0043] For the preparation method of artificial feed and the structure of the incubator, please refer to the references (Li Caixia, Gao Lifeng, Gao Lingling, Li Runzhi. Research on raising aphids in pure artificial nutrient solution. Journal of Shanxi Agricultural University, 1997, 17(3): 225-228.Li C X, Gao L F, Gao L L, Li R Z. Study on the rearing of aphids on an artificially solid diets. Journal of Shanxi Agricultural University, 1997, 17(3):225-228. (in Chinese)). Filter the artificial feed with a bacterial filter with a pore size of 0.2 μm, dispense it into 2.0 mL sterilized centrifuge tubes, and store it in a -20°C refrigerator to avoid repeated freezing and thawing.

[0044] 2. Application of dsRNA in inhibiting the growth of aphids

[0045] See the references for the feeding method of Aphid aphid: Jiao Min...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a dsRNA (double-stranded ribonucleic acid) for inhibiting expression of wheat aphid cytochrome C oxidase VIIc subunit gene and application thereof. The invention provides a dsRNA molecule disclosed as Sequence 2 in the sequence table. The invention also provides a DNA (deoxyribonucleic acid) molecule for coding the RNA molecule. The invention also provides application of the RNA molecule or the DNA molecule, which is at least one of the following (1) to (4): (1) preventing and treating aphids; (2) promoting death of aphids; (3) inhibiting growth of aphids; and (4) inhibiting expression of the aphid in-vivo cytochrome C oxidase VIIc subunit gene. The dsRNA has important application value in preventing and treating aphids in agricultural production.

Description

technical field [0001] The invention relates to dsRNA for inhibiting gene expression of wheat aphid cytochrome C oxidase VIIc subunit and application thereof. Background technique [0002] Wheat aphids (especially wheat aphids) are one of the main pests that harm wheat production in China. According to statistics, the area damaged by wheat aphids in China every year can reach as high as 17 million hectares, accounting for 62% of the total wheat planting area, resulting in a 15% reduction in production- 30%, up to 50% in severe cases. In recent years, due to factors such as global warming and changes in farming systems, the reproductive ability and adaptability of aphids have been significantly enhanced, and their harm has become increasingly serious. At present, the control of aphids is mainly based on spraying pesticides, which are not only harmful to humans and animals, but also cause serious environmental pollution. Breeding aphid-resistant wheat varieties is the most e...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/113A01N57/16A61P7/04
Inventor 夏兰琴王大海孙永伟杜文明
Owner INST OF CROP SCI CHINESE ACAD OF AGRI SCI