Diagnosis chip of recessive pathogenic genetic genes of Parkinson disease

A technology of recessive inheritance and pathogenic genes, applied in the field of Parkinson's disease recessive genetic pathogenic gene diagnosis chip, can solve the problems of difficult gene detection, cost, manpower and material resources, etc., to improve the early diagnosis rate and reduce misdiagnosis efficiency and low cost

Active Publication Date: 2014-03-26
XIANGYA HOSPITAL CENT SOUTH UNIV
View PDF1 Cites 6 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0004] Due to the clinical heterogeneity and polygenic inheritance of Parkinson's disease, genetic testing brings great difficulties and requires considerable manpower and material resources

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Diagnosis chip of recessive pathogenic genetic genes of Parkinson disease
  • Diagnosis chip of recessive pathogenic genetic genes of Parkinson disease

Examples

Experimental program
Comparison scheme
Effect test

Embodiment

[0015] The gene diagnosis chip for Parkinson's disease of the present invention has a total of 96 mutation point sequences, all of which are AR-PD, wherein parkin 23, PINK1 19, DJ-1 6, ATP13A2 14, PLA2G6 25, FBXO7 9.

[0016] The gene diagnosis chip for Parkinson's disease of the present invention is to immobilize probes capable of hybridizing with mutation points on optical fiber microbeads, and the sequence table of the probes is:

[0017] serial number sequence 1 ctggcgccgctgcgcgcatgggcctgttcctggcccgcagccgccacctacccagtgaccwtgataggtacgtgggtacctgccaggtacagcctctctgcgccgccccacgccccggtat 2 gcatcttccagctcaaggaggtggttgctaagcgacagggggttccggctgaccagttgcstgtgattttcgcagggaaggagctgaggaatgactggactgtgcaggtgagtctcccttg 3 tgtgacctggatcagcagagcattgttcacattgtgcagagaccgtggagaaaaggtcaakaaatgaatgcaactggaggcgacgaccccagaaacgcggcgggaggctgtgagcgggagc 4 ggaggcgacgaccccagaaacgcggcgggaggctgtgagcgggagccccagagcttgactygggtggacctcagcagctcagtcctcccaggagactctgtg...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

A diagnosis chip of recessive pathogenic genetic genes of a Parkinson disease has 96 mutational site sequences, namely 23 Parkin, 19 PINK1, 6 DJ-1, 14 ATP13A2, 25 PLA2G6 and 9 FBXO7. The chip comprises the following test steps of: fabricating an SUD plate, resuspending the SUD plate, fabricating an ASE plate, adding MEL, performing preliminary work on PCR (Polymerase Chain Reaction), combining PCR products, preparing a pre-chip sample, performing chip hybridization, cleaning and scanning the chip, and reading and analyzing data. The diagnosis chip of the recessive pathogenic genetic genes of the Parkinson disease is low in cost, and can screen the recessive pathogenic genetic genes of the Parkinson disease conveniently and rapidly.

Description

technical field [0001] The invention relates to a gene diagnosis chip, in particular to a Parkinson's disease recessive genetic pathogenic gene diagnosis chip. Background technique [0002] Parkinson's disease (PD), also known as paralysis agitans, is a common degenerative disease of the nervous system. Lewy body (LB) formation in vivo is characteristic. It is generally believed that Parkinson's disease is related to multiple factors such as genetics, environment, and aging. With the development of molecular biology, more and more attention has been paid to the role of genetic factors in the pathogenesis of Parkinson's disease. At least 18 pathogenic loci of Parkinson's disease have been located and 13 pathogenic genes have been cloned. In terms of inheritance, PD can be inherited as autosomal dominant prkinson's disease (AD-PD), autosomal recessive parkinson's disease (AR-PD), and some cases are sporadic. Usually Parkinson's disease is more common in the elderly. The in...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
Patent Type & Authority Applications(China)
IPC IPC(8): C12Q1/68C40B40/06
CPCC12Q1/6883C12Q2600/156
Inventor 郭纪锋唐北沙严新翔娄明星
Owner XIANGYA HOSPITAL CENT SOUTH UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap