A recessive gene diagnosis chip for Parkinson's disease
A technology of recessive inheritance and disease-causing genes, which is applied in the field of Parkinson's disease recessive genetic disease-causing gene diagnosis chip, can solve the problems of gene detection difficulty, cost, and large manpower and material resources, so as to improve the early diagnosis rate and reduce misdiagnosis The effect of high efficiency and low cost
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment
[0015] The gene diagnosis chip for Parkinson's disease of the present invention has a total of 96 mutation point sequences, all of which are AR-PD, wherein parkin 23, PINK1 19, DJ-1 6, ATP13A2 14, PLA2G6 25, FBXO7 9.
[0016] The gene diagnosis chip for Parkinson's disease of the present invention is to immobilize probes capable of hybridizing with mutation points on optical fiber microbeads, and the sequence table of the probes is:
[0017] Numbering sequence 1 ctggcgccgctgcgcgcatgggcctgttcctggcccgcagccgccacctacccagtgaccwtgataggtacgtgggtacctgccaggtacagcctctctgcgccgccccacgccccggtat 2 gcatcttccagctcaaggaggtggttgctaagcgacagggggttccggctgaccagttgcstgtgattttcgcagggaaggagctgaggaatgactggactgtgcaggtgagtctcccttg 3 tgtgacctggatcagcagagcattgttcacattgtgcagagaccgtggagaaaaggtcaakaaatgaatgcaactggaggcgacgaccccagaaacgcggcgggaggctgtgagcgggagc 4 ggaggcgacgaccccagaaacgcggcgggaggctgtgagcgggagccccagagcttgactygggtggacctcagcagctcagtcctcccaggagactctgtg...
PUM

Abstract
Description
Claims
Application Information

- R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com