Unlock instant, AI-driven research and patent intelligence for your innovation.
DNA (Deoxyribonucleic Acid) library and method for constructing transcription activator like effector nuclease plasmids
What is Al technical title?
Al technical title is built by PatSnap Al team. It summarizes the technical point description of the patent document.
A DNA library and transcription activation technology, applied in the field of genetic engineering, can solve the problems of difficulty, cumbersome operation, and high cost, and achieve the effects of avoiding damage and degradation, simple operation steps, and improved production technology
Active Publication Date: 2014-03-26
浙江煦顼技术有限公司
View PDF1 Cites 6 Cited by
Summary
Abstract
Description
Claims
Application Information
AI Technical Summary
This helps you quickly interpret patents by identifying the three key elements:
Problems solved by technology
Method used
Benefits of technology
Problems solved by technology
But they all have their own defects, because the chemical synthesis of highly repetitive sequences of DNA to be synthesized is very difficult and the cost is very high; the two-step method requires two steps of connection, so the material cost, time cost, and sequencing cost are all high; the now public The only method that can be connected in one step can only connect up to 14 recognition modules, and the length of common recognition modules in nature is 12-23. The limitation not only affects the application of this method, but also is not conducive to the improvement of TALEN specificity, and because of the need for enzyme digestion, purification, and re-ligation, the operation is cumbersome, the process is complicated, and the DNA after enzyme digestion and purification is difficult to store, especially single-stranded DNA. tail easily degrades
[0006] In the past, some researchers connected TALEN with a single module, such as connecting 18 recognition modules. It is very difficult to connect 18 fragments in one reaction, and no one in the world has been able to achieve it; Can connect 14 identification modules
Method used
the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more
Image
Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
Click on the blue label to locate the original text in one second.
Reading with bidirectional positioning of images and text.
Smart Image
Examples
Experimental program
Comparison scheme
Effect test
Embodiment 1
[0041] Example 1 Connection between TALENs recognition modules and construction of recombinant vector
[0042] 1. Acquisition of 20 identification modules (modular)
[0043] (1) The synthesis recognizes 4 single bases A, T, C, G and 16 double bases AA, AT, AC, AG, TA, TT, TC, TG, CA, CT, CC, CG, GA, 20 identification modules for GT, GC, GG NI, NG, HD, NN, NI-NI, NI-NG, NI-HD, NI-NN, NG-NI, NG-NG, NG-HD, NG-NN, The sequences of HD-NI, HD-NG, HD-HD, HD-NN, NN-NI, NN-NG, NN-HD, and NN-NN are shown in Table 1, as shown in SEQ ID NO: 1-20, respectively.
[0044] Table 1
[0045]
[0046]
[0047]
[0048] 2. Make 172 plasmid libraries by adding restriction sites and linkers to the basic modules
[0049] (1) PCR amplification to add enzyme-cut recognition sequences and connection adapters
[0050] F1, R1; F2, R2; F3, R3; F4, R4; F5, R5; F6, R6; F7, R7; F8, R8; F9, R9 as primers, T vector containing 16 double modules as template Do PCR, a total of 16×9=144;
[0051] Us...
Embodiment 2
[0102] connect identifiable bases
[0103] Fragment 1: TALEN of CGCGCGCGCGCGCGCGCGCGT (SEQ ID NO: 47), Fragment 2 CCCACTCCCCATCCAGT (SEQ ID NO: 48).
[0104] (1) First select the required recognition module from the PCR library:
[0105] CGCGCGCGCGCGCGCGCGT selects modules CG-1, CG-2, CG-3, CG-4, CG-5, CG-6, CG-7, CG-8, CG-9; this connection vector is pEF1a-NLS-TALE backbone- Fok1(R)-pA
[0106] CACTCCCCATCCAGT select modules C-1, A-2, C-3, TC-4, CC-5, CA-6, TC-7, CA-8, GT-9. The connection vector is pEF1a-NLS-TALE backbone-Fok1(L)-IRES-PURO-pA
[0107] (2) According to the following connection system:
[0108] Vector: 150ng
[0109] Modulars: 50ng / modular
[0110] Bsa I (NEB): 1ul
[0111] T4Ligase (fermentas): 1ul
[0112] T4Buffer (NEB): 2ul
[0113] h 2 O: make up 20ul
[0114] The ligation program was: 5 min at 37°C; 15 cycles at 16°C for 10 min; 10 min at 80°C.
[0115] (3) Then plasma-safenuclease digestion: 1h.
[0116] (4) Transform Trans-T1 competent, pi...
the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More
PUM
Login to View More
Abstract
The invention discloses a DNA (Deoxyribonucleic Acid) library and a method for constructing transcription activator like effector nuclease plasmids. A Tale connecting celllibrary comprises 16 groups*n double-base identifying modules and 4 groups*n single-base identifying module; and a first viscous tail end and a second viscous tail end which are formed by enzymedigestion of two restriction enzymes are arranged on two tail ends of each double-base identifying module or each single-base identifying module; the DNAlibrary comprises plasmids which are as many as connecting units of the Tale connecting cell library; each plasmid comprises a connecting unit with mutually different base sequences; and Bsa I enzymedigestion sites are provided at junctions of the two tail ends of each connecting unit and an original carrier. The DNA library disclosed by the invention is adopted to construct transcription activator like effector nuclease plasmids; enzymedigestion and connection of the identifying modules can be carried out in one reaction, so that 12-19 identifying modules can be further connected, and therefore, the method is quick in speed, high in efficiency, simple to operate, easy for storing materials and low in cost.
Description
technical field [0001] The invention relates to the field of genetic engineering, in particular to a Tale junction unit library, a DNA library comprising all Tale junction units in the Tale junction unit library and a method for constructing a transcription activator-like effectornucleaseplasmid. Background technique [0002] It has always been the dream of many scientists to modify the genome according to human wishes. Specifically delete or add the sequences we need on the endogenous genome. On the one hand, various animal models can be constructed for basic biological research and disease mechanism research. On the other hand, animal reactors can be produced to produce what we need cheaply. Biological components that are difficult to obtain from other sources. People have not found a simple and efficient method for genome-targeted modification of the genome. Traditional gene targeting technology relies on the random exchange of homologous chromosomes naturally occurri...
Claims
the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More
Application Information
Patent Timeline
Application Date:The date an application was filed.
Publication Date:The date a patent or application was officially published.
First Publication Date:The earliest publication date of a patent with the same application number.
Issue Date:Publication date of the patent grant document.
PCT Entry Date:The Entry date of PCT National Phase.
Estimated Expiry Date:The statutory expiry date of a patent right according to the Patent Law, and it is the longest term of protection that the patent right can achieve without the termination of the patent right due to other reasons(Term extension factor has been taken into account ).
Invalid Date:Actual expiry date is based on effective date or publication date of legal transaction data of invalid patent.