Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Small RNA used for psoriasis treatment, and derivatives and medicinal preparations thereof

A technology for pharmaceutical preparations and psoriasis, applied in the field of small RNA and its derivatives and pharmaceutical preparations, can solve the problems of unclarified CREB1 gene, reduction, etc., to reduce epidermal thickening, promote hair growth, and improve keratinization Effect

Inactive Publication Date: 2014-04-23
黄兵
View PDF7 Cites 3 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Silencing MSK1 and MSK2 can inhibit the expression of CREB1, while knocking out MSK1 can also effectively reduce the expression of immune molecules directly related to psoriasis, such as IL-6, IL-8 and TNFα. However, the above studies did not clarify the CREB1 gene Whether the knockout can also inhibit the expression of cytokines TNFα, etc.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Small RNA used for psoriasis treatment, and derivatives and medicinal preparations thereof
  • Small RNA used for psoriasis treatment, and derivatives and medicinal preparations thereof
  • Small RNA used for psoriasis treatment, and derivatives and medicinal preparations thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0041] Small RNA siRNA-1 can significantly inhibit the mRNA expression of CREB1 and ATF1 in human keratinocytes. By designing hundreds of small RNA molecules and conducting a large number of experiments, 29 of them were finally screened out. They can inhibit the target gene Creb1 to varying degrees. and the expression of Atf1, the sequences of the 29 small RNA molecules are shown in Table 1.

[0042] Table 1. Small RNA single-stranded sequences (the other is the complementary strand).

[0043] sRNAs Sequence 5' to 3' siR-1 GAAACCCCAUCUCUACUAAUU siR-2 AGGAGCAAUACAGCUGGCUAAACAAU siR-3 GCAAUACAGCUGGCUAACAAUGGUA siR-4 CACUCAGCCGGGUACUACCAUUCUA siR-5 GCACGAAAGAGAGAGGUCCGUCUAA siR-6 CACGAAAGAGAGAGGUCCGUCUAAU siR-7 GAAAGAGAGAGGUCCGUCUAAUGAA siR-8 CAGCUCGAGAGUGUCGUAGAAAGAA siR-9 ACAAGACAUUGAUUGAGGAGCUAAA siR-10 CCUUUACTGCCACAAAUCAGAUUAA siR-11 CACUGUAACGGUGCCAACUCCAAUU miR-12 UGAUCGAAUAUGUAU...

Embodiment 2

[0048] Small RNAsi-CR1 can effectively inhibit the expression of target gene CREB1 and immune regulation gene TNFα in mouse skin.

[0049] Select 4 female mice aged 6-8 weeks, cut the hair on the back of each mouse with ophthalmic surgical scissors, select two pieces of skin with an area of ​​0.5 square centimeters, and one piece of skin is smeared with transfected polypeptide and small RNA negative control NC. The drug control was delivered, and another piece of skin was smeared with the compound drug formed by the transfected polypeptide and small RNAsi-CR1. After continuous administration of 2 μg each time twice a day for 5 days, the mice were sacrificed, and the skin tissues of the administration and negative control sites were collected. Combined into two groups, the total RNA was isolated by using the tissue RNA isolation kit of Tiangen Biotechnology Company and according to the method described in its instructions. Take 2 μg of total RNA, carry out reverse transcription...

Embodiment 3

[0051] Small RNA si-CR1 can effectively improve the degree of skin inflammation in psoriasis model mice.

[0052] One of the main features of psoriasis is that the lesion area has the characteristics of inflammation, so whether the inflammation of the experimental animal skin is improved or not is an important model to study the treatment of psoriasis drugs. In recent years, it has been reported that imiquimod paint, a small-molecule drug for the treatment of external genital / perianal warts, has the pathological effects of inducing skin epithelial inflammation and hyperkeratinization in mice, and has some pathological features of psoriasis , considered to be a better modeling drug for the study of psoriasis (van der Fits L., et al., Imiquimod-Induced Psoriasis-Like Skin Inflammation in Mice Is Mediated via the IL-23 / IL-17Axis.J .Immun. 2009, 182, 5836-5845). The present invention adopts the imiquimod cream produced by Hubei Keyi Pharmaceutical Co., Ltd. - Likejie, adopts the ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a small RNA used for psoriasis treatment, and derivatives and medicinal preparations thereof. The small RNA inhibits the expression of psoriasis pathopoiesis related gene products comprising TNF alpha, IL-1a, IL6 and IL by inhibiting the expression of CREB1 and ATF1. The above small RNA medicines can substantially improve the psoriasis model mouse skin symptom formed after smearing mice with a 5% Imiquimod cream in an external use mode, can mitigate the cuticle thickening degree of pathologic skins, can improve the skin keratinization, can promote the hair growth of the pathologic skins, and has a certain treatment effect on the psoriasis.

Description

technical field [0001] The invention relates to the field of gene medicine, in particular to the small RNA and its derivatives and pharmaceutical preparations which can be used for treating psoriasis. Background technique [0002] Psoriasis, also known as psoriasis, is a chronic infectious skin disorder with a prevalence rate of 1 to 3% of the world's population. In 1984, 24 provinces, municipalities, and autonomous regions in my country conducted epidemiological surveys, and the prevalence rate was 0.123%, accounting for about 5-6% of dermatology clinics. [0003] Non-infectious red infiltrated spots appeared on the lesioned skin of the patient with obvious boundaries. The abnormal hyperplasia and abnormal differentiation of keratinocytes led to epidermal hyperplasia, accompanied by lymphocyte infiltration and epidermal vascular dilation and spread. [0004] So far, people's understanding of the pathogenesis of psoriasis is still very limited, and it is generally considere...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): A61K48/00C12N15/113C12N15/63A61P17/06
Inventor 黄兵殷勤伟张洪杰
Owner 黄兵
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com