Molecular identification method for lasiohelea taiwana

A midge and gene technology is applied in the field of molecular identification of midges in Taiwan to achieve the effect of shortening identification time and accurate identification

Active Publication Date: 2014-05-21
FUJIAN INT TRAVEL HEALTH CARE CENT
View PDF2 Cites 17 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0007] At present, the molecular identification of blood-sucking midges still mainly uses a single gene (such as only the COI gene or ITS gene), and there are few reports on the identification of blood-sucking midges by combining two different genes.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Molecular identification method for lasiohelea taiwana
  • Molecular identification method for lasiohelea taiwana
  • Molecular identification method for lasiohelea taiwana

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0043] Example 1 Acquisition of the COI gene sequence of the midges in Taiwan.

[0044] 1. Acquisition of Taiwan midge specimens

[0045] Formosan midges bred in batches in the laboratory were killed by freezing and stored in 95% ethanol directly. The species of Taiwan midges have been reviewed by authoritative experts before batch breeding.

[0046] 2. DNA template preparation

[0047] Using the micro-DNA template preparation method of small insects to extract the DNA of midges in Taiwan (Editor-in-Chief Wen Lizhang. Introduction to Entomological Research Methods and Techniques [M]. Beijing: Science Press, 2010.278-286), the extracted DNA samples were stored at -20°C spare.

[0048] 3. Primer synthesis

[0049] The primers used in this example are as follows:

[0050] Forward primer 5’GGT CAA CAA ATC ATA AAG ATA TTG G 3’

[0051] Reverse Primer 5’TAA ACT TCA GGG TGA CCA AAA AAT CA 3’

[0052] 4. PCR amplification

[0053] The PCR reaction system of this embod...

Embodiment 2

[0064] Example 2 Acquisition of the ITS2 Gene Sequence of the Formosan midge

[0065] 1. Primer synthesis

[0066] With the Taiwan midge DNA obtained in Example 1 as a template, primers were synthesized, and the primer sequences used were as follows:

[0067] Forward primer 5'GATGAAGACCGCAGCAAACT 3'

[0068] Reverse primer 5'ATTTGGGGGTAGTCACACAT 3'

[0069] 2. PCR amplification

[0070] The PCR reaction system of this embodiment is shown in Table 3.

[0071] Table 3 The PCR reaction system of the ITS 2 gene of the Taiwan midge midge (take 50uL as an example)

[0072]

[0073] The reaction procedure of this embodiment is shown in Table 4.

[0074] Table 4 PCR reaction program of ITS 2 gene of the midges in Taiwan

[0075]

[0076] 3. PCR amplification product detection

[0077] Take 5 μL of the PCR amplification product and electrophoresis with 1% agarose gel (130V voltage, electrophoresis for 35 min). Ethidium bromide staining, gel imaging system detection, e...

Embodiment 3

[0080] Example 3 Identification of unknown midges

[0081] 1. Collection and preservation of specimens

[0082] The collected specimens were collected by waving nets or human inducement, and the collected specimens were killed by freezing and stored in 95% ethanol directly.

[0083] 2. DNA template preparation

[0084] Under a dissecting mirror or a stereo microscope, a female midge was randomly selected from the collected midge specimens, and the DNA of the midge was extracted by using the small-scale insect DNA template preparation method (Wen Lizhang, editor-in-chief. Entomological research methods and techniques Introduction [M]. Beijing: Science Press, 2010.278-286), the extracted DNA samples were stored at -20°C for future use.

[0085] 3. Acquisition of target gene sequence

[0086] 3.1 COI gene

[0087] 3.1.1 Primer synthesis

[0088] The obtained unknown midge DNA is used as a template to synthesize primers, and the primer sequences used are as follows:

[0089]...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a molecular identification method for lasiohelea taiwana. The method is characterized in that two different genes, namely a COI gene and an ITS2 gene are adopted to be combined, and the lasiohelea taiwana is subjected to species identification by comparison of the similarity of the gene sequences. By adopting the molecular identification method for lasiohelea taiwana provided by the invention, accurate and rapid identification of the lasiohelea taiwana is facilitated. A basis is provided for molecular identification of the lasiohelea taiwana. The new variety can play a certain role in transmission of plant pollen and environment harmless reaction.

Description

technical field [0001] The invention relates to the field of species identification, in particular to a method for molecular identification of midges in Taiwan. Background technique [0002] Taiwan midge ( Lasiohelea taiwana Shiraki, 1913) commonly known as the small black mosquito, is a kind of tiny blood-sucking midges common in southern my country, belonging to the genus Ceratopogonidae (Ceratopogonidae) of the order Diptera ( Lasiohelea ), which is the Taiwan midge species group ( La. taiwana group) is very similar to other species (especially females) in the species group, and it is difficult to accurately identify it morphologically. [0003] The identification and recognition of blood-sucking midges is the basis for monitoring and controlling the occurrence of midge-borne diseases, and it is also the core step in the field of disease prevention and control. At present, the identification of blood-sucking midges mainly depends on the identification of morphologi...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12N15/12C12N15/11C12Q1/68
Inventor黄恩炯高博张晓龙张华荣王飞鹏肖菲菲
OwnerFUJIAN INT TRAVEL HEALTH CARE CENT