Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Site-directed mutagenesis system of mustard genome and application of site-directed mutagenesis system

A genome-specific, gene-based technology, which is applied in genetic engineering, recombinant DNA technology, and the introduction of foreign genetic material using vectors, can solve the problem of mustard gene editing and transformation technology that has not yet been reported, and achieve the effect of enriching genetic resources.

Inactive Publication Date: 2014-06-18
SOUTHWEST UNIVERSITY
View PDF4 Cites 5 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Although technologies such as transgenic and RNAi have been widely used in the research of mustard breeding, the technology that can directly edit and transform the mustard gene has not been reported yet.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Site-directed mutagenesis system of mustard genome and application of site-directed mutagenesis system
  • Site-directed mutagenesis system of mustard genome and application of site-directed mutagenesis system
  • Site-directed mutagenesis system of mustard genome and application of site-directed mutagenesis system

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0016] Embodiment 1, the acquisition of mustard FRIGIDA gene fragment

[0017] A fragment of the mustard FRIGIDA-b gene containing the first exon and the first intron was amplified by a primer pair (upstream 5'‐TGCCTACAAACACGGAAAT‐3', downstream 5'‐AAGGGCCATACAAATGCTAT‐3'). This example takes the first exon as the target point.

Embodiment 2

[0018] Embodiment 2, the design of the first exon nuclease TALEN-L and TALEN-R

[0019] According to the characteristics of the first exon sequence of the mustard FRIGIDA gene, the 3' end sequence of the first exon was selected as the target sequence of the transcription activator effector nuclease TALEN-L and TALEN-R. According to the TALEN recognition principle, the designed TALEN recognition target sequence is 5'‐TGAGATTGCTGCTGCTctaaaacggtcacctttccttgtCCCTATGATGTCAGGTA‐3', the uppercase part is the recognition module of the transcription activator effector nuclease TALEN‐L and TALEN‐R, and the lowercase part is the spacer sequence, where the 5' The TALEN-L recognition module (SEQ ID NO1) at the end, and the TALEN-R recognition module (SEQ ID NO4) at the 3' end. Finally, the nuclear localization signal was set upstream of the TALEN protein, and the nuclease FokI was set downstream to obtain TALEN-L and TALEN-R with recognition modules and fusion nuclease FokI. Design the co...

Embodiment 3

[0023] Example 3, TALEN-L and TALEN-R functional verification

[0024] The binary expression vectors of TALEN-L and TALEN-R were constructed to transform Agrobacterium GV3101, and the positive recombinants were detected to infect the hypocotyls of Brassica juncea. Induce the regeneration plant to extract the genome, use T7 endonuclease to detect mutations, the detection system is T7E1buffer2μl, DNA2μl, T7E11μl, ddH 2 05 μl. Then use the primer pair (upstream 5'‐TGCCTACAAACACGGAAAT‐3', downstream 5'‐AAGGGCCATACAAATGCTAT‐3') to amplify the mutant FRIGIDA gene fragment, the PCR reaction system is: ddH 2 O32.8μl, 10×PCR buffer5μl, 2mM dNTP5μl, 25mM MgSO43μl, upstream and downstream primers 1.5μl, KOD DNAPolymerase (Toyobo)1μl, template DNA1μl. The fragment was then cloned into the pMD19‐T vector for sequencing, and mutants (such as figure 1 , figure 2 shown).

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to a site-directed mutagenesis system of a mustard genome and an application of the site-directed mutagenesis system' and belongs to the technical field of biology. The site-directed mutagenesis system of the mustard genome is characterized by comprising two transcription activator-like effector nucleases (TALEN) in two target sequences of a specifically-recognized target gene, wherein the target sequences include a first target sequence and a second target sequence, the first target sequence is located at a 5'-terminal of the target gene, and the second target sequence is located at a 3'-terminal of the target gene; the two transcription activator-like effector nucleases include transcription activator-like effector nucleases TALEN-L and TALEN-R which can specifically recognize the first target sequence and the second target sequence. The invention further discloses an application of a deletion system. According to the application, rich breeding materials can be provided, and the site-directed mutagenesis system has a wide application prospect.

Description

technical field [0001] The invention relates to the field of biotechnology, in particular to a genome site-directed mutation system based on TALEN technology and its application. Background technique [0002] Mustard is an annual or biennial herb of the Brassica family (Cruciferae). It is a famous specialty vegetable in China, which is rarely cultivated in Europe and the United States, and originated in Asia. In the past ten years, reverse genetics technology has been widely used in the research and genetic breeding of plant germplasm resources. People have prepared and screened mutants in crops in various ways, and have established a variety of methods, such as EMS Chemical mutagenesis, TILLING, but these methods have their own limitations. The present invention constructs a TALEN binary expression vector applied to eggplant, and uses the transcription activator effector nuclease (TALEN) to modify the mustard FRIGIDA gene in vitro, which provides important theoretical sig...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N9/22C12N15/82
CPCC12N9/22C07K14/415C07K2319/80C12N15/827
Inventor 宋明孙梓健李念祖汤青林王志敏
Owner SOUTHWEST UNIVERSITY
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com