Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Cotton stress response-related protein ghgebp and its coding gene and application

A technology for encoding genes and proteins, applied to cotton stress response-related genes and their encoded proteins and applications, can solve problems such as no research reports, and achieve the effects of enriching gene resources, and improving salt tolerance and ABA tolerance.

Active Publication Date: 2017-10-13
CHINA AGRI UNIV
View PDF0 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, there is no research report on the role of GeBP in plant stress resistance.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Cotton stress response-related protein ghgebp and its coding gene and application
  • Cotton stress response-related protein ghgebp and its coding gene and application
  • Cotton stress response-related protein ghgebp and its coding gene and application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0041] Example 1. Preparation of cotton GhGeBP gene

[0042] Genomic DNA and total RNA were extracted with G5 hydroponic seedlings of Gossypium hirsutum L. as materials; the extracted total RNA was reverse transcribed to obtain cDNA; Genomic DNA and cDNA were used as templates, and GhG1F and GhG1R were used as templates. The primers are used for PCR amplification. The primer sequences for the above PCR amplification are as follows:

[0043] GhG1F: 5’ATTTGCTATTGCCTCCTTCCCTGTT3’

[0044] GhG1R: 5’GAGCTACAGATACCCCCCATGATTG3’

[0045] The PCR reaction system is 50μl, the reaction system is: 2μl template (cDNA or genomic DNA), 1μl primer (10μM), 5μl 10×LA buffer, 8μl dNTP (2.5mM each), 0.5μl LA-Taq enzyme, 34.5μl ddH 2 O.

[0046] The PCR reaction program is: 94℃5min, 1cycle; 94℃30s, 60℃30s, 72℃90s (2min), 30cycles; 72℃10min, 4℃∞, 1cycle.

[0047] The obtained PCR amplification product was subjected to 1% agarose gel electrophoresis, and the fragments were recovered, connected to pMD18-Tvec...

Embodiment 2

[0048] Example 2, GhGeBP gene function verification

[0049] (1) Expression analysis of GhGeBP gene under salt stress

[0050] Plant G5 hydroponic seedlings in cotton, Hoagland nutrient solution hydroponics. When the seedlings grow to the three-leaf one-heart stage, they are treated with 150mM NaCl solution, and the control is ordinary Hoagland nutrient solution. The roots, stems and leaves of the control are treated with 150mM NaCl solution for 0.5h and the roots, stems and leaves of the control are respectively treated with 150mM NaCl solution for 0.5h. , Used for RNA extraction. 3 copies of each material.

[0051] The total RNA of cotton was extracted by the modified CTAB method, and cDNA was obtained by reverse transcription. The GhG3F and GhG3R were used as primers and GhActin was used as the internal reference gene for RT-PCR analysis. The primer sequence is as follows:

[0052] GhG3F: 5’GGAGGCGAAATGGAGGAAATTGC3’

[0053] GhG3R: 5’GAGCTACAGATACCCCCCATGATTG3’

[0054] See RT-PCR...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses upland cotton GhGeBP protein and a coding gene and application thereof. The protein GhGeBP is a protein with one of the following amino acid residue sequences of 1) an amino acid residue sequence shown as the sequence table of SEQ ID No. 2; (2) the protein GhGeBP is a protein obtained by substitution and / or deletion and / or addition of one or a plurality of amino acid residues of the amino acid residue sequence shown as the sequence table of SEQ ID No. 2, and is a plant stress response related protein derived from 1). The protein and its encoding gene can be used to breed high salt resistant cotton varieties (lines), and have good application prospect.

Description

Technical field [0001] The invention belongs to the fields of agricultural plant genetic improvement technology and plant biotechnology application, and specifically relates to a cotton stress response related gene and its coded protein and application. Background technique [0002] GeBP (GL1enhancer binding protein) is a unique transcription factor family in plants. Arabidopsis contains 23 members, and 5 member genes of this family are found in upland cotton. Julien Curaba et al. (2003) reported that GeBP is mainly expressed in the meristems of vegetative organs and young leaf primordia, and acts as a repressor to determine the fate of leaf cell differentiation; Chevalier et al. (2008) showed that GeBP and GeBP-like proteins It encodes a new type of non-conservative transcription factor protein containing a leucine zipper structure, and this type of protein participates in the Cytokinin pathway, inhibiting the negative regulatory effect of ARR gene on cytokinin response. Perazz...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C07K14/415C12N15/29C12N15/82C12N5/10C12N1/21C12N15/11A01H5/00
CPCC07K14/415C12N15/8271C12N15/8273
Inventor 华金平苏莹张曦甄军波王玉美
Owner CHINA AGRI UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com