Cotton stress response-related protein ghgebp and its coding gene and application
A technology for encoding genes and proteins, applied to cotton stress response-related genes and their encoded proteins and applications, can solve problems such as no research reports, and achieve the effects of enriching gene resources, and improving salt tolerance and ABA tolerance.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0041] Example 1. Preparation of cotton GhGeBP gene
[0042] Genomic DNA and total RNA were extracted with G5 hydroponic seedlings of Gossypium hirsutum L. as materials; the extracted total RNA was reverse transcribed to obtain cDNA; Genomic DNA and cDNA were used as templates, and GhG1F and GhG1R were used as templates. The primers are used for PCR amplification. The primer sequences for the above PCR amplification are as follows:
[0043] GhG1F: 5’ATTTGCTATTGCCTCCTTCCCTGTT3’
[0044] GhG1R: 5’GAGCTACAGATACCCCCCATGATTG3’
[0045] The PCR reaction system is 50μl, the reaction system is: 2μl template (cDNA or genomic DNA), 1μl primer (10μM), 5μl 10×LA buffer, 8μl dNTP (2.5mM each), 0.5μl LA-Taq enzyme, 34.5μl ddH 2 O.
[0046] The PCR reaction program is: 94℃5min, 1cycle; 94℃30s, 60℃30s, 72℃90s (2min), 30cycles; 72℃10min, 4℃∞, 1cycle.
[0047] The obtained PCR amplification product was subjected to 1% agarose gel electrophoresis, and the fragments were recovered, connected to pMD18-Tvec...
Embodiment 2
[0048] Example 2, GhGeBP gene function verification
[0049] (1) Expression analysis of GhGeBP gene under salt stress
[0050] Plant G5 hydroponic seedlings in cotton, Hoagland nutrient solution hydroponics. When the seedlings grow to the three-leaf one-heart stage, they are treated with 150mM NaCl solution, and the control is ordinary Hoagland nutrient solution. The roots, stems and leaves of the control are treated with 150mM NaCl solution for 0.5h and the roots, stems and leaves of the control are respectively treated with 150mM NaCl solution for 0.5h. , Used for RNA extraction. 3 copies of each material.
[0051] The total RNA of cotton was extracted by the modified CTAB method, and cDNA was obtained by reverse transcription. The GhG3F and GhG3R were used as primers and GhActin was used as the internal reference gene for RT-PCR analysis. The primer sequence is as follows:
[0052] GhG3F: 5’GGAGGCGAAATGGAGGAAATTGC3’
[0053] GhG3R: 5’GAGCTACAGATACCCCCCATGATTG3’
[0054] See RT-PCR...
PUM

Abstract
Description
Claims
Application Information

- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com