The marker mmu-mir-217-5p that can detect Toxoplasma gondii infection
A technology of toxoplasma gondii and base sequence, which is applied in the determination/testing of microorganisms, DNA/RNA fragments, recombinant DNA technology, etc., can solve problems that affect diagnosis, low specificity and sensitivity, and difficulty in making a diagnosis. Achieve high sensitivity and specificity, reliable detection basis
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1B
[0016] Example 1 BALB / c challenge experiment
[0017] Sixty BALB / c mice aged 6-8 weeks were randomly divided into 3 groups, 20 mice in each group, and the tachyzoites of RH strain and ME49 strain were injected intraperitoneally into the two groups respectively. 6 The third group was the healthy control group, and the infection of parasites was determined by Giemsa staining method and blood smear DNA method.
Embodiment 2
[0018] Example 2 plasma total RNA extraction
[0019] 72 hours after infection, the anticoagulant blood of all mice was obtained by taking blood from the eyeball. Centrifuge the anticoagulated blood at room temperature at 1200g / min for 10 minutes, take the supernatant and then centrifuge at 12000g / min at 4°C for 10 minutes, and take the supernatant as the processed plasma sample.
[0020] Extraction of plasma total RNA using mirVana TM miRNAIsolationKit (Ambion, USA) kit, the synthesized cel-miR-39 is added to the plasma as an external reference, and the specific steps are as follows:
[0021] 1. Add 600 μL 2×DenaturingSolution to every 600 μL plasma, mix well, and incubate on ice for 5 minutes.
[0022] 2. Add 1200 μL phenol chloroform, vortex for 1 minute, and centrifuge at 10000 g / min for 5 minutes.
[0023] 3. Take the supernatant and add 1.25 times the volume of ethanol, filter the mixture through a column, centrifuge at 10000g / min for 30 seconds, and discard the filte...
Embodiment 3
[0027] The establishment of embodiment 3 reverse transcription and Q-PCR system
[0028] 1. Reverse transcription
[0029] 50 ng of total RNA was reverse-transcribed using the miScriptII ReverseTranscription kit (Qiagen, Germany). The reaction system is shown in Table 1. The liquid was mixed and incubated at 37°C for 1 hour, then kept in a water bath at 95°C for 5 minutes, and kept at -20°C for a long time.
[0030] Table 1 Reverse transcription reaction system
[0031]
[0032] 2. Q-PCR
[0033] Q-PCR was performed for mmu-miR-217-5p.
[0034] Table 2 Basic information related to mmu-miR-217-5p
[0035]
[0036] Using the cDNA obtained by reverse transcription as a template, the miRNA primers containing the sequence TACTGCATCAGGAACTGACTGGA synthesized by Qiagen (Qiagen Biotechnology Co., Ltd., No. 88 Darwin Road, Zhangjiang High-tech Park, Pudong, Shanghai) were used for Q-PCR amplification, and miScriptSYBRGreenPCRKit( Qiagen, Germany), the reaction system is shown...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More