Supercharge Your Innovation With Domain-Expert AI Agents!

Method for increasing content of zeaxanthin in anabaena

A technology of zeaxanthin and Anabaena, applied in the biological field, can solve problems such as no disclosure

Inactive Publication Date: 2014-06-25
NINGBO UNIV
View PDF1 Cites 4 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0005] At present, there are no relevant research reports on the method of increasing the content of zeaxanthin by expressing Dunaliella salina β-carotene hydroxylase gene in Anabaena at home and abroad

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for increasing content of zeaxanthin in anabaena
  • Method for increasing content of zeaxanthin in anabaena
  • Method for increasing content of zeaxanthin in anabaena

Examples

Experimental program
Comparison scheme
Effect test

specific Embodiment

[0036] A method for improving zeaxanthin content in Anabaena, specifically comprising the following steps:

[0037] 1. Extract Dunaliella salina RNA, refer to the PrimeScript? RT Master Mix kit instructions, and use RNA as a synthetic reverse transcription template;

[0038] 2. Acquisition of Dunaliella salina β-carotene hydroxylase gene

[0039] According to the open reading frame of Dunaliella salina β-carotene hydroxylase gene (accession number: JN118489), the upstream primer chyb-orf-F: CGGGATCCATGCAGGCGCTACCGCTCCAG and the downstream primer chyb-orf–R: CGGAATTCCTACACTCTTTGGACGCCACAGCT were designed, and the PCR reaction system was: dd h 2 O 9.5 μl, Premix Ex Taq TM Hot Start Version 12.5 μl, chyb-orf–F 1 μl, chyb-orf-R 1 μl, Dunaliella salina cDNA 1 μl, the reaction program is: pre-denaturation at 94°C for 5 minutes, 1 cycle; denaturation at 94°C for 45s, annealing at 55°C 45s, 72°C extension for 1 min, 32 cycles; 72°C extension for 10 min, 1 cycle; 4°C storage, PCR pr...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a method for increasing content of zeaxanthin in anabaena. The method is characterized by comprising the following specific steps: cloning critical rate-limiting enzyme gene beta-carotene hydroxylase gene for synthesis of zeaxanthin from dunaliella salina teodoresce, constructing the gene into a shuttle expression vector pRL25C, and transferred into anabaena by a triparetal conjugation method, genetically modified anabaena is obtained by resistance screening, and after 16000Lx high-light treatment, the method has the advantage that the content of zeaxanthin in genetically modified anabaena is increased greatly compared with wild type anabaena, and can be increased by 3.8 times to the greatest extent.

Description

technical field [0001] The invention relates to the field of biotechnology, in particular to a method for increasing the content of zeaxanthin by expressing Dunaliella salina beta-carotene hydroxylase gene in Anabaena. Background technique [0002] Zeaxanthin (3,3'-dihydroxy-β-carotene), as a natural terpene-like unsaturated carotenoid, can be chemically synthesized by the Wittig method. However, chemically synthesized zeaxanthin is not only difficult to be absorbed by the human body, but even harmful to the human body. At present, only zeaxanthin extracted from natural plants or algae has biological activities such as antioxidant. Natural zeaxanthin is mainly found in vegetables (spinach, kale, corn, pepper, etc.), flowers (calendula, marigold flowers, etc.) and fruits (wolfberry, sweet orange), and zeaxanthin also exists in the yolk of poultry eggs (eggs, quail eggs), but the content is low. Like other carotenoids, zeaxanthin has a conjugated double bond structure, which...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/74C12N1/21C12R1/89C12R1/01
Inventor 伏建平龚一富章丽陈梦丹刘晓丹潘益芳
Owner NINGBO UNIV
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More