A method for detecting alterations in low-abundance molecules

A sample and primer pair technology, applied in the fields of biotechnology and medicine, can solve problems such as the inability to achieve high-sensitivity detection

Active Publication Date: 2016-04-13
CREATIVE BIOSCIENCES (GUANGZHOU) CO LTD
View PDF3 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0006] Another important aspect is that the above-mentioned detection methods are all for normal samples to be tested, but for old paraffin samples with poor quality, serious fragmentation or long storage time, these methods cannot achieve high sensitivity detection

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • A method for detecting alterations in low-abundance molecules
  • A method for detecting alterations in low-abundance molecules
  • A method for detecting alterations in low-abundance molecules

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0039] 1. Primers: The inventor found a pair of primers through a large number of exploratory experiments KRAS Specific primer pair for gene codon 4-14 mutation KRAS -76-F / KRAS -76-R; the sequence is as follows:

[0040] KRAS -76-F: AGGCCTGCTGAAAATGACTG (shown in SEQ ID NO: 1);

[0041] KRAS -76-R: GCAAGAGTGCCTTGACGATA (shown in SEQ ID NO: 2);

[0042] 2. Test method: firstly, the inventors verified the mixture of plasmids with different ratios of mutation ratios to see whether the mutation rate of 0.1% could be detected as stated in the literature. The detection sensitivity of the method according to the invention was determined.

[0043] 2.1. Use plasmid standards (100% mutant plasmid and 100% wild type plasmid) to configure mixed plasmids with different mutation ratios, 100% mutation, 90% mutation, 80% mutation, 70% mutation, 60% mutation, 50% mutation , 40% mutation, 30% mutation, 20% mutation, 10% mutation, 5% mutation, 2.5% mutation, 1% mutation, 0.5% mutation, 0...

Embodiment 2

[0053] Utilize the specific primer pair of the present invention KRAS -76-F / KRAS -76-R, verification of digitalHRM method detection results and sequencing method detection results of DNA templates of cancer specimens from different sources (gastric cancer, colon cancer, rectal cancer, esophageal cancer, pelvic cancer, pancreatic cancer, anal canal cancer, breast cancer, lung cancer) consistency rate.

[0054] The specific operation is as follows: select the DNA of paraffin specimens of different diseases as shown in Table 1 below for digitalHRM detection, and use the sequencing method to verify the detection results. The experimental method, experimental apparatus and relevant reaction conditions are as shown in Example 1.

[0055] Table 1

[0056] sample number pathological diagnosis Sequencing results digital HRM results Remark A1 stomach cancer Wild type Wild type See figure 2 shown A2 colon cancer GGT-GAT mutant See image 3 ...

Embodiment 3

[0059]DNA samples with severe fragmentation and poor quality are selected and detected using the method of the present invention. The experimental method, experimental apparatus and relevant reaction conditions are as shown in Example 1. Poor quality DNA samples are defined as: samples whose initial DNA concentration is lower than 50ng / μl, or the ratio of ultraviolet absorption A260 / A280 is lower than 1.6 or greater than 2.0. Select the samples described in Table 2 according to the above requirements.

[0060] Table 2

[0061] Sample serial number Concentration (ng / μl) Purity (A260 / 280) B1 32.6 1.343 B2 33 1.365 B3 23.3 1.245 B4 52.6 1.623 B5 54.9 2.598 B6 203.9 2.118

[0062] While using the method described in Example 1 of the present invention to detect the mutation status of the samples in Table 2, the present invention also uses the common PCR method to detect the samples in Table 2. The common PCR reaction system an...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
Sensitivityaaaaaaaaaa
Login to View More

Abstract

The invention belongs to the fields of biotechnology and medicine, and specifically relates to a method for detecting changes in low-abundance molecules, which is a method using a digital high-resolution melting curve (hereinafter referred to as digital? HRM), combined with a pair of specific primers KRAS -76-F / KRAS- 76-R, detection KRAS A method for mutation of codons 4-14 of the gene. The method of the present invention can realize the detection of all samples to be tested (including old paraffin samples with poor quality, severe fragmentation or long storage time) in low cost, fast and high sensitivity. KRAS Rapid and accurate detection of gene codon 4-14 mutations.

Description

technical field [0001] The invention relates to the fields of biotechnology and medicine, in particular to a method for detecting changes in low-abundance molecules, which is a detection method using digitalHRM KRAS A method for mutation of codons 4-14 of the gene. Background technique [0002] There are three genes in the ras gene family associated with human tumors—— HRAS, KRAS and NRAS , located on chromosomes 11, 12 and 1, respectively. KRAS It is also known as the p21 gene because it encodes a 21kD ras protein. In the ras gene, KRAS Most important in human cancer, it is a molecular switch that, when normal, controls pathways that regulate cell growth; when abnormal, it causes cells to continue growing and prevents them from self-destructing. It participates in intracellular signal transmission when KRAS When the gene is mutated, the gene is permanently activated, unable to produce normal ras protein, causing intracellular signal transduction disorder, cell proli...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityPatents(China)
IPC IPC(8): C12Q1/68C12N15/11
CPCC12Q1/6858C12Q2527/107
Inventor邹鸿志傅新晖陈志婷麦炽雄黄京林
OwnerCREATIVE BIOSCIENCES (GUANGZHOU) CO LTD