A method for quantitative determination of NH4+ uptake rate of rice ammonium transporter protein osamt1;1
An ammonium transporter and absorption rate technology is applied in the field of rice ammonium transporter gene OsAMT1, which can solve the problem of not being able to clearly explain the absorption mechanism of rice, and achieve the effect of convenient operation.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0042] Embodiment 1 Rice OsAMT1;1 –Construction of pYES2 yeast expression vector, see the construction flow chart figure 1 .
[0043] Rice ammonium transporter gene with registration number AF289477 in GeneBank OsAMT1;1 , its nucleic acid sequence is SEQIDNO1:
[0044] ATGGCGACGTGCGCGGCGGACCTGGCGCCGCTGCTGGGGCCGGTGGCGGCGAACGCGACG60
[0045] GACTACCTGTGCAACCGGTTCGCCGACACGACGTCGGCGGTGGACGCGACGTACCTGCTC120
[0046] TTCTCGGCGTACCTCGTGTTCGCCATGCAGCTCGGGTTCGCGATGCTCTGCGCCGGGTCG180
[0047] GTGCGGGCCAAGAACACGATGAACATCATGCTCACCAACGTGCTCGACGCCGCGGCCGGG240
[0048] GCGCTCTTCTACTACCTCTTCGGCTTCGCCTTCGCCTTCGGCACGCCGTCCAACGGCTTC300
[0049] ATCGGGAAGCAGTTCTTCGGCCTCAAAGCACATGCCGCAGACCGGGTTCGACTACGACTTC360
[0050] TTCCTCTTCCAGTGGGCCTTCGCCATCGCCGCCGCCGGGATCACGTCGGGCTCCATCGCC420
[0051] GAGAGGACGCAGTTCGTCGCCTACCTCATCTACTCCGCCTTCCTCACCGGGTTCGTCTAC480
[0052] CCGGTGGTGTCCCACTGGATCTGGTCCGCCGATGGGTGGGCCTCTGCCTCCCGCACGTCC540
[0053] GGACCTCTGCTGTTCGGCTCCGGTGTCATCGACTTCGCCGGCTCCGGCGT...
Embodiment 2
[0085] Example 2 Obtaining of Recombinant Positive Engineering Bacteria OsAMT1;1-pYES2 / 31019b and Control Strain OsAMT1;1
[0086] The yeast ammonium transporter deletion mutant 31019b (gifted by Prof. Nicovon Wirén, University of Hohenheim, Germany) was used as the host strain, which will contain the target gene OsAMT1;1 - pYES2 and the empty vector pYES2 were transferred into it respectively, and the target transformants were screened as test materials. The recombinant plasmid obtained in Example 1 OsAMT1;1 -pYES2 and empty vector pYES2 were mixed with 31019b yeast competent cells respectively, electroporated with a MicroPulser electrotransformer (BioRad), and 1ml of pre-cooled sorbitol was added immediately, and the cultures were evenly spread on yeast selective cells after incubation. medium plate (transformed OsAMT1;1 -pYES2 and pYES2 each plate), 30°C, dark culture for 3 days, pick a single yeast colony, in 3ml liquid yeast selective medium, culture at 30°C for 36h, ...
Embodiment 3
[0087] Example 3 Recombinant Positive Engineering Bacteria OsAMT1;1-pYES2 / 31019b Determination of absorption rate under different ammonium concentration conditions
[0088] In this example, the recombinant positive engineering bacteria is OsAMT1;1-pYES2 / 31019b obtained in Example 2, and the control strain is pYES2 / 31019b obtained in Example 2.
[0089] (1) Take the single positive clones of the recombinant positive engineering bacteria and the control strain and insert them into 3ml of liquid yeast selective medium, respectively, at 30°C, 220rpm, and cultivate for about 40h;
[0090] (2) Transfer the cultured recombinant positive engineering bacteria and control strains to 500ml liquid yeast selective medium respectively, with an inoculum size of 8%, and culture them on a shaker at 30°C and 220rpm for 4h until their OD The value reached 0.6;
[0091] (3) Collect and distribute the bacterial cells into centrifuge tubes. Separate the control strain and recombinant positive...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 