Unlock instant, AI-driven research and patent intelligence for your innovation.

A method for quantitative determination of NH4+ uptake rate of rice ammonium transporter protein osamt1;1

An ammonium transporter and absorption rate technology is applied in the field of rice ammonium transporter gene OsAMT1, which can solve the problem of not being able to clearly explain the absorption mechanism of rice, and achieve the effect of convenient operation.

Inactive Publication Date: 2016-01-20
INST OF SOIL SCI CHINESE ACAD OF SCI
View PDF0 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, only qualitative research on the function of rice AMT gene cannot clearly explain the mechanism of ammonium uptake by rice, and quantitative data is still needed, and there is no literature report on the quantitative determination of the rate of ammonium uptake by rice AMT gene

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • A method for quantitative determination of NH4+ uptake rate of rice ammonium transporter protein osamt1;1
  • A method for quantitative determination of NH4+ uptake rate of rice ammonium transporter protein osamt1;1
  • A method for quantitative determination of NH4+ uptake rate of rice ammonium transporter protein osamt1;1

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0042] Embodiment 1 Rice OsAMT1;1 –Construction of pYES2 yeast expression vector, see the construction flow chart figure 1 .

[0043] Rice ammonium transporter gene with registration number AF289477 in GeneBank OsAMT1;1 , its nucleic acid sequence is SEQIDNO1:

[0044] ATGGCGACGTGCGCGGCGGACCTGGCGCCGCTGCTGGGGCCGGTGGCGGCGAACGCGACG60

[0045] GACTACCTGTGCAACCGGTTCGCCGACACGACGTCGGCGGTGGACGCGACGTACCTGCTC120

[0046] TTCTCGGCGTACCTCGTGTTCGCCATGCAGCTCGGGTTCGCGATGCTCTGCGCCGGGTCG180

[0047] GTGCGGGCCAAGAACACGATGAACATCATGCTCACCAACGTGCTCGACGCCGCGGCCGGG240

[0048] GCGCTCTTCTACTACCTCTTCGGCTTCGCCTTCGCCTTCGGCACGCCGTCCAACGGCTTC300

[0049] ATCGGGAAGCAGTTCTTCGGCCTCAAAGCACATGCCGCAGACCGGGTTCGACTACGACTTC360

[0050] TTCCTCTTCCAGTGGGCCTTCGCCATCGCCGCCGCCGGGATCACGTCGGGCTCCATCGCC420

[0051] GAGAGGACGCAGTTCGTCGCCTACCTCATCTACTCCGCCTTCCTCACCGGGTTCGTCTAC480

[0052] CCGGTGGTGTCCCACTGGATCTGGTCCGCCGATGGGTGGGCCTCTGCCTCCCGCACGTCC540

[0053] GGACCTCTGCTGTTCGGCTCCGGTGTCATCGACTTCGCCGGCTCCGGCGT...

Embodiment 2

[0085] Example 2 Obtaining of Recombinant Positive Engineering Bacteria OsAMT1;1-pYES2 / 31019b and Control Strain OsAMT1;1

[0086] The yeast ammonium transporter deletion mutant 31019b (gifted by Prof. Nicovon Wirén, University of Hohenheim, Germany) was used as the host strain, which will contain the target gene OsAMT1;1 - pYES2 and the empty vector pYES2 were transferred into it respectively, and the target transformants were screened as test materials. The recombinant plasmid obtained in Example 1 OsAMT1;1 -pYES2 and empty vector pYES2 were mixed with 31019b yeast competent cells respectively, electroporated with a MicroPulser electrotransformer (BioRad), and 1ml of pre-cooled sorbitol was added immediately, and the cultures were evenly spread on yeast selective cells after incubation. medium plate (transformed OsAMT1;1 -pYES2 and pYES2 each plate), 30°C, dark culture for 3 days, pick a single yeast colony, in 3ml liquid yeast selective medium, culture at 30°C for 36h, ...

Embodiment 3

[0087] Example 3 Recombinant Positive Engineering Bacteria OsAMT1;1-pYES2 / 31019b Determination of absorption rate under different ammonium concentration conditions

[0088] In this example, the recombinant positive engineering bacteria is OsAMT1;1-pYES2 / 31019b obtained in Example 2, and the control strain is pYES2 / 31019b obtained in Example 2.

[0089] (1) Take the single positive clones of the recombinant positive engineering bacteria and the control strain and insert them into 3ml of liquid yeast selective medium, respectively, at 30°C, 220rpm, and cultivate for about 40h;

[0090] (2) Transfer the cultured recombinant positive engineering bacteria and control strains to 500ml liquid yeast selective medium respectively, with an inoculum size of 8%, and culture them on a shaker at 30°C and 220rpm for 4h until their OD The value reached 0.6;

[0091] (3) Collect and distribute the bacterial cells into centrifuge tubes. Separate the control strain and recombinant positive...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a method for quantitatively measuring rice ammonium transporter protein OsAMT1;1? The method of NH4+ absorption rate: use the deposit number as CGMCC? No.7254 Saccharomyces cerevisiae ( Saccharomyces ? cerevisiae ) Recombinant positive engineering bacteria and control strains quantitatively measure their absorption rates under different 15NH4+ substrate concentrations, and subtract the 15NH4+ absorption rate of the corresponding concentration of the control strain from the absorption rate of the recombinant positive engineering bacteria at each 15NH4+ concentration. Ammonium absorption rate of rice ammonium transporter protein OsAMT1; Using this gene to carry out bioengineering breeding lays a theoretical foundation.

Description

technical field [0001] The invention relates to a rice ammonium transporter gene OsAMT1;1 Constructed into the yeast expression vector pYES2 to obtain recombinant plasmids OsAMT1;1 -pYES2, and transform the recombinant plasmid into yeast ammonium transporter deletion mutant strain 31019b to obtain Saccharomyces cerevisiae ( Saccharomyces cerevisiae ) recombinant engineering bacteria OsAMT1;1-pYES2 / 31019b, OsAMT1;1 - After expression of pYES2 in 31019, the ammonium transporter deletion strain 31019b was able to regain the ability to absorb ammonium to 15 NH 4 Cl as a substrate, and using 15 The N isotope absorption measurement technology can quantitatively measure the ammonium absorption rate of the rice ammonium transporter OsAMT1;1 under different ammonium concentration conditions in the outside world, thereby quantitatively determining the ammonium absorption function of OsAMT1;1, which belongs to the field of biotechnology. Background technique [0002] Ammonium nit...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12Q1/02C12N15/81C12N1/19C12R1/865
Inventor 杨顺瑛苏彦华丛郁金曼郝东利
Owner INST OF SOIL SCI CHINESE ACAD OF SCI