A preparation method of a vector specifically expressing mir-505 in the central nervous system

A technology of egfp-mir-505 and central nervous system, which is applied in the introduction of foreign genetic material using vectors, recombinant DNA technology, etc., can solve the problems of easy loss of phenotype and unrepeatable experimental results, and achieve easy copy number and stable genetic characteristics. , the effect of easy identification

Inactive Publication Date: 2016-04-06
DONGHUA UNIV
View PDF2 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Due to copy number dilution and gene silencing after passage of transgenic mice, the phenotype of the same strain is also easily lost during passage, resulting in unrepeatable experimental results

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • A preparation method of a vector specifically expressing mir-505 in the central nervous system
  • A preparation method of a vector specifically expressing mir-505 in the central nervous system
  • A preparation method of a vector specifically expressing mir-505 in the central nervous system

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0029] 1) Acquisition of EGFP-mir-505 gene

[0030] Using pcDNA6.2-EGFP-miR505 as a template, PCR amplification was performed with the following pair of primers to obtain the EGFP-mir-505 gene, which is about 1400 bp in length and whose sequence is shown in SEQ ID NO:1.

[0031] Pegfp-miR-505forward:

[0032] GCGCATGCCTAGAGAACCCACTGCTTAC

[0033] Pegfp-miR-505reverse:

[0034] GCAAGCTTGCTATGGCAGGGCCTGCCG

[0035] System: (15ul)

[0036]

[0037] Program: 93°C 1min30s; (93°C 30s, 57°C 30s, 65°C 2min) *40; 65°C 10min

[0038] Recover the PCR product:

[0039]

concentration

A260 / A280

Pegfp-miR-505-3P

64.4 / 59.4ng / ul

1.88 / 1.89

Pegfp-NC

55.2 / 52.9ng / ul

1.89 / 1.93

[0040] PCR product double digestion reaction:

[0041]

[0042] PCR product nc810ng; 3p930ng

[0043] 37°C 3h; 65°C 20min

[0044] Purification and recovery of enzyme digestion products:

[0045] nc23.5 / 23.8ng / ul

[0046] 3p14.9 / 14.3ng / ul

[0047] 2)...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention relates to a preparation method of vector for specific expression of miR-505 in a central nervous system. The method comprises the following steps: obtaining a target gene by PCR; digesting a GFAP promoter from a pAAV-GFAP-hchR2-mcherry-WPRE vector by appropriate restriction endonuclease; cloning the GFAP promoter and the target gene on a pUC19 vector; digesting a GFAP-EGFP-mir-505 fragment from the pUC vector by appropriate enzyme digestion sites; and cloning the fragment ont a PB vector, thereby obtaining the vector. The vector together with an auxiliary vector expressing transposase can be co-injected into male pronucleus of mouse zygotes, so that a transgenic mouse can be obtained and the transgenic mouse can be used for researching the biological functions (including regulatory sexual development) of miR-505 in a nervous system and especially in neuroglia cells; besides, EGFP proteins can conveniently show the locations of exogenous genes in the nervous system.

Description

technical field [0001] The invention belongs to the field of transgenic mice, and in particular relates to a preparation method of a vector specifically expressing miR-505 in the central nervous system. Background technique [0002] MicroRNA is a single-stranded small molecule RNA with a length of 21-25 bases, which is produced by processing a single-stranded RNA precursor with a hairpin structure of about 70-90 bases in size by Dicer enzyme. Since the first miRNA was reported in 1993, it has been found that miRNAs are involved in the regulation of almost all important biological processes [BartelDP (2004) MicroRNAs: genomics, biogenesis, mechanism, and function. Cell116 (2): 281-297], Abnormal expression of miRNAs is associated with various human diseases [AmbrosV, Zhu Wanqu (2010): MicroRNAs and Disease and Developmental Life Sciences 3:27-29]. So far, more than 700 human-derived miRNAs have been identified that regulate the expression of more than one-third of human gene...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
Patent Type & Authority Patents(China)
IPC IPC(8): C12N15/66
Inventor 周宇荀仝莉李晓宁肖君华李凯
Owner DONGHUA UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap