Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Sesame dominant nuclear male sterility gene molecular marker and its preparation method and application

A male sterility gene and molecular marker technology, applied in biochemical equipment and methods, DNA/RNA fragments, microbial determination/inspection, etc. question

Inactive Publication Date: 2016-09-21
INST OF OIL CROPS RES CHINESE ACAD OF AGRI SCI
View PDF0 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

The main problems in the development of my country's sesame industry are: ①The output is often low and unstable, hovering at the level of 70 kg per mu for a long time (Yang Mei, Huang Fenghong. The status quo and existing problems, development trends and countermeasures of China's sesame industry. China Oil , 2009, 34(1):7-12); ② Poor disease resistance, prone to stem point blight and Fusarium wilt, and no immune or highly resistant materials have been found so far (Zhang X R, Zhao Y Z, Cheng Y, Feng X F, et al. Establishment of sesame germplasm corecollection in China. Genetic Resources and Crop Evolution, 2000, 47: 273-279); ③ poor appearance quality, low oil content, weak market competitiveness
However, recurrent selection generally requires timely removal of 50% of the fertile plants in the sterile line at the initial flowering stage (Zhang Lisen, Jiang Qingfen, Tai Lifang. Briefing on recurrent selection breeding of dominant genic male sterile wheat in Taigu. Journal of Hebei Agricultural University, 1989, 12 (4): 143-144), while the morphological characteristics of sesame W1098AB sterile plants and fertile plants are very similar, and they cannot be distinguished during the vegetative growth period. They can only be distinguished according to the presence or absence of pollen after flowering, which is very time-consuming and laborious, and cannot be removed. A large amount of pollen pollution will be produced in time, which will affect the selection efficiency

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Sesame dominant nuclear male sterility gene molecular marker and its preparation method and application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0041] A preparation method of sesame dominant nuclear male sterility gene molecular marker, the steps are:

[0042] 1. Obtaining the fragments related to dominant nuclear male sterility in sesame:

[0043] A. Experimental materials and population construction: In 2002, 5 wild sesame resources were introduced from India, one of which was "Yezhi 2" ( Sesamum malabaricum Burm, 2n=26) can grow normally and successfully hybridized with the cultivar "Ezhi 1". From a distant hybrid (Yezhi 2×Ezhi 1) F 1 Several plants with the highest sterility rate were selected by substitution and backcrossed with Ezhi No. 1, and this was repeated for 2 generations, and then the obtained BC 2 The best sterile plants in the population were selected for brother-sister crossing with the fertile plants, and the population with a sterile plant rate close to 50% was selected as the offspring for about 4 consecutive generations of sibling crossing, and a new sesame male sterile line W1098AB was bred. ...

Embodiment 2

[0060] A kind of application of the molecular marker of sesame dominant nuclear male sterility gene in the selection of sesame parents, the steps are:

[0061] A. Construction of sesame dominant nuclear male sterile segregation population: select the fertile and sterile strains in the dominant nuclear male sterile line of artificial bagging and hybridization for multiple generations, and then carry out brother-sister crossing to obtain F 0 generation seed, for F 1 The plants are covered with large mosquito nets for reproductive isolation planting to obtain fertile segregated populations.

[0062] B. Fertility identification: During the full-flowering period of sesame, the fertility identification of each single plant of the segregated group of siblings is carried out in the field. Since there is basically no difference between the sterile anther and the fertile anther of the sterile line with the naked eye, after pinching the anther It is difficult to determine whether each i...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
concentrationaaaaaaaaaa
Login to View More

Abstract

The invention discloses a molecular marker of sesame dominant genic male sterility gene and a preparation method and application thereof. A forward primer sequence of the marker GB50 is ATGGGTTTATGGCAGGCT, and a reverse primer sequence is GGACTACTCCTCCTCCCCA; a forward primer sequence of SBM298 is CCCCTTTTCACTTACGTACAGCAG, and a reverse primer sequence is CTCTTCCTCCACCATCTCCTCTTC. The preparation method comprises the steps of: A, respectively numbering dominant genic male sterility brother-sister inbreeding segregation population in the seedling stage, collecting tender leaves from each individual plant, treating by liquid nitrogen and storing in a refrigerator for standby; B, conducting biosynthesis by using EST-SSR primers of SBM series; C, amplifying by a PCR procedure; D, conducting PCR amplification and product detection; E, acquiring a polymorphism marker; and F, acquiring a molecular marker associated with male sterility. The method can obtain 100% male sterility population, significantly improve the efficiency of sesame recurrent selection, and avoid the trouble of eradication of 50% fertile plants until the flowering phase by using morphological characteristics. The invention has obvious effect, low cost, no pollution and very broad application prospects.

Description

technical field [0001] The invention belongs to the field of sesame genetic breeding and molecular biology, and more specifically relates to a sesame dominant nuclear male sterility gene molecular marker, and also relates to a method for preparing a sesame dominant nuclear male sterility-related molecular marker, and also relates to a sesame dominant nuclear male sterility related molecular marker. The application of sesame dominant nuclear male sterility molecular markers in molecular marker-assisted selection to improve the efficiency of high-yield breeding using sesame dominant nuclear male sterility genes. Background technique [0002] Sesame is one of the main oil crops in my country. Sesame oil has pure aroma and high nutritional value, and is known as the "king of oils". The annual sesame planting area in my country is about 600,000 hectares, accounting for one-tenth of the world's total area, with a total output of 600,000-700,000 tons, accounting for a quarter of th...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12N15/11C12Q1/68
Inventor 刘红艳赵应忠吴坤杨敏敏
Owner INST OF OIL CROPS RES CHINESE ACAD OF AGRI SCI
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products