High-immobilization-tendency heparinase I coding gene and protein thereof

A technology encoding gene and heparinase is applied in the field of easy immobilization of heparinase I encoding gene and its protein, and can solve the problems of low immobilization efficiency and high cost

Inactive Publication Date: 2014-10-01
SHENZHEN HEPALINK PHARMA GRP CO LTD
View PDF3 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

At present, there are few studies on the immobilization of heparanase I. Howard Bernstein et al [Bernstein, H., (1987), Appl. Biochem. Biotech. 16, 129-143] used CNBr-activated Sepharose 4B as the immobilization material, Heparanase I was immobilized by the covalent cross-linking method to realize the immobilization of heparanase, but the immobilization efficiency of this method is low, and the results obtained by using the same materials and methods can only reach the immobilization rate per milliliter of material. 1IU of heparanase I, and the cost of using CNBr-activated Sepharose 4B as immobilized material is relatively high

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • High-immobilization-tendency heparinase I coding gene and protein thereof
  • High-immobilization-tendency heparinase I coding gene and protein thereof
  • High-immobilization-tendency heparinase I coding gene and protein thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0021] Example 1. Deletion of the expression of the heparanase I protein HepA-1.

[0022] 1. Construction of the expression vector pMal-HepA-1-chBD.

[0023] The construction of the template PMal-HepA refers to the patent, the patent number is CN 1312183C.

[0024] The specific process of constructing the expression vector pMal-HepA-1-chBD is as follows: the constructed PMAL-HepA and the chitin-binding domain plasmid PMD19T are used as templates, and the upstream and downstream primers used are GACTGGATCCcaggccgacagtgctaag (the underlined base is BamHI restriction site), and GGTCAGGCCAAGTTTtctggcagtttcgctgt 3 and, with 5 CAGCGAAACTGCCAGAAAACTTGGCCTGACCGGT and 5 GACTAAGCTTCTATTGAAGCTGCCACAAGGC 3, introduce BamHI and HindIII restriction sites respectively, and then recover and purify PMAL-HepA-1 and chitin-binding domain plasmid The PMD19T-chBD PCR product was used as a template to amplify the coding gene with GACTGGATCCcaggccgacagtgctaag and GACTAAGCTTCTATTGAAGCTGCCACAAGGC 3 ...

Embodiment 2

[0028] Example 2. Purification of heparanase I protein HepA-1-chBD by amylose column and determination of heparanase HepA-1-chBD activity.

[0029] 1. Purification of Heparanase Ⅰ protein HepA-1-chBD.

[0030] The fusion partner (fusion partner) maltose binding protein MBP used in the present invention can achieve one-step separation with amylose affinity adsorption. The specific affinity separation steps are as follows: after induction of 0.7mmol IPTG-induced bacterial expression for 20 hours, the bacterial solution was centrifuged at 8000rpm for 10min, and the filtrate was discarded and resuspended in 40ml 20mmol Tris. Ultrasonic 5s, intermittent time 5s, ultrasonic 200 cycles), centrifuged at 18000rpm.30min. After centrifugation, the supernatant was passed through a 20ml pre-equilibrated amylose affinity separation column at 0.5ml / min, eluted and collected by a gradient of 10mM 0.5ml / min maltose.

[0031] The target protein can be eluted with 10 mM maltose at 10 column vo...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
Molecular weightaaaaaaaaaa
Login to View More

Abstract

The invention discloses a high-immobilization-tendency heparinase I protein and a coding gene thereof. The protein can be efficiently immobilized by chitin. The amino acid sequence of the high-immobilization-tendency heparinase I protein is disclosed as SEQ ID NO:2, and the coding gene of the protein is also within the protection range. The PCR (polymerase chain reaction) technique is superposed and extended to design the heparinase I gene and chitin combination domain to fuse and express the immobilizable heparinase I.

Description

technical field [0001] The invention relates to the genetic engineering transformation of enzymes, in particular to the coding gene of easily immobilized heparanase I and its protein. Background technique [0002] Heparinase refers to a class of enzymes that can specifically cleave the glycosidic bonds of heparin and heparin-like main chains. It was first discovered and isolated from Flavobacterium heparinus. Later, heparin was also found in some microorganisms and animal tissues. Enzymes are present. Heparinase has the functions of removing residual heparin in the blood and preventing blood coagulation. It also plays an important role in the production of low-molecular-weight heparin and the study of the structure of heparin. However, free heparanase is easily inactivated, especially the activity of heparanase I solution is only 23% after storage for 96 hours. In addition, free heparanase needs to be added to the substrate when it reacts. After the reaction, the enzyme Th...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N9/88C12N15/60C12N1/21C12R1/19
CPCC12N9/88C12Y402/02007
Inventor杜宏银马小来李锂
OwnerSHENZHEN HEPALINK PHARMA GRP CO LTD