Caragana korshinskii Kom. transcription factor CkMYB4 and its gene
A Caragana caragana, transcription factor technology, applied in genetic engineering, plant genetic improvement, angiosperms/flowering plants, etc., can solve the problems of large proportion of G-type lignin, thick stems, value impact, etc.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0014] Example 1. Cloning of Caragana caragana CkMYB4 gene
[0015] The one-month-old seedlings of Caragana caragana were used in the experiment, and the leaves of the Caragana seedlings were clipped and placed in a 1.5mL centrifuge tube, quickly frozen in liquid nitrogen, and stored in a -80°C refrigerator for later use. Total RNA was extracted by TRIzole method (Invitrogen), and cDNA was obtained by reverse transcription using reverse transcription reagents (see Kit DRR019A, TaKaRa, Treasure Bioengineering Dalian Co., Ltd. for specific operations). The above reverse-transcribed cDNA product was used for nested PCR with the following primers.
[0016] MYB4-1ATGGGMMGGTCHCCKTGY
[0017] MYB4-2GTGTTCCARTARTTCTTWATYTCRTTR
[0018] MYB4-3CTCACACAAACAAAGGDGCRT
[0019] MYB4-4TTCCAATAGTTCTTDATYTCRTTRT
[0020] PCR amplification conditions:
[0021] MYB4-1 and MYB4-2 were used as primers for the first round of PCR.
[0022]
[0023] The first round of PCR product was diluted...
Embodiment 2
[0042] The construction of the CkMYB4 plant expression vector was carried out by conventional molecular biology methods, and the full-length ORF of the CkMYB4 gene was excised from the pEASY-Blunt-T vector by using the XhoI and SalI restriction sites added by the primers, and connected into the plant with the CaMV35S promoter In the expression vector PBI-xs, a binary expression vector was obtained, and after PCR and enzyme digestion identification, it was transformed into Agrobacterium GV3101, and after the plasmid was extracted and PCR, enzyme digestion was identified correctly, wild-type Arabidopsis thaliana was transformed by flower dipping method ( Columbia type, Col), the transgenic Arabidopsis was screened by Kan resistance on the plant expression vector PBI-xs, and screened and identified by PCR ( figure 1 ,2).
Embodiment 3
[0043] Example 3. Detection of lignin synthase-related gene expression in CkMYB4 gene-transferred Arabidopsis
[0044] The expression levels of genes related to lignin synthesis in Arabidopsis were detected by fluorescent quantitative PCR technology. The internal reference gene primers were designed according to the Arabidopsis EF1α gene sequence published in the GeneBank database.
[0045] F-AtEF1α-RT: AGAAGGGTGCCAAATGATGAG
[0046]F-AtEF1α-RT: GGAGGGAGAGAGAAAGTCACAGA
[0047] use Green I fluorescent dye method, on the LightCycler480 (Roche Diagnostics) real-time fluorescent quantitative PCR instrument, carry out the transcriptional expression level analysis of gene, 2 -△△Ct method to analyze the data. Results The expression levels of Arabidopsis lignin synthesis-related gene AtCAD1 were significantly increased in the five transgenic lines detected, while the expression levels of AtCAD5 and AtPAL1 were also increased in most of the transgenic lines ( image 3 ). This s...
PUM

Abstract
Description
Claims
Application Information

- Generate Ideas
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com