Kit used for detecting number of human chromosomes 21

A technology for the number of chromosomes and detection reagents, applied in the field of molecular biology, can solve the problems of DNA quality difference, inaccuracy of results, annealing temperature changes, etc.

Inactive Publication Date: 2014-10-08

钦州市妇幼保健院

4 Cites 4 Cited by

AI-Extracted Technical Summary

Problems solved by technology

However, due to the use of two pairs of primers to amplify different fragments, very small changes in annealing temperature or differences in DNA quality will cause false negative or false positive results, resulting in inaccurate results (Helmy SM, Ismail S, Bassiouni R, et al.Sensitivity of DCSR3/GAPDH ratio using quantitative real-time PCR in the rapid prenatal diagnosis for down syndrome[J...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine

Abstract

The invention discloses a kit used for detecting the number of human chromosomes 21. The kit comprises an amplification detection reagent, wherein the amplification detection reagent comprises a primer pair used for simultaneously amplifying specific repetitive sequences of chromosomes 21 and specific repetitive sequences of chromosomes 11, a fluorescent probe used for specifically detecting the specific repetitive sequences of the chromosomes 21 and a fluorescent probe used for specifically detecting the specific repetitive sequences of the chromosomes 11. The kit has the beneficial effects that the kit adopts a pair of primers to simultaneously amplify a pair of similar sequences between different chromosomes, thus avoiding mutual interference or other interferences caused by amplifying different sequences by different primers and ensuring the consistency of the amplification efficiency; the fluorescent probes are selectively designed in the DNA sequence sites with base difference so that the amplification volumes of two sequences can be respectively detected accurately via deltaCT values of real-time fluorescent PCR (polymerase chain reaction) of repeat segments, thus further improving the accuracy and reliability of the detection results and reducing the probability of causing false negative or false positive results.

Application Domain

Microbiological testing/measurement

Technology Topic

FluorescenceBioinformatics +6

Image

Examples

Experimental program(2)

Example Embodiment

[0019] Example 1: Using the kit of the present invention to detect normal samples and 21-trisomy samples to be tested

[0020] 1. The composition of the kit:

[0021] 1.1 Selection of target sequence and design of primers and probes

[0022] Detection site: Select the specific repetitive sequence chr21-2 on chromosome 21 and the specific repetitive sequence chr11-1 on chromosome 11 (chr21-2 and chr11-1 are two similar sequences) as relative real-time fluorescent quantitative PCR amplification and Detection sequence, such as figure 1 As shown, where:

[0023] The base sequence of the specific repetitive sequence chr21-2 on chromosome 21 is: 5'-gtgccattgacacaggaggacccatgcctgagaaagacttttatctgagttactgagattaagatgttttgaagctcccaagcagagggatgctggatctgctgtggaaatctggctggctgagcagctgcaggaaatctggctgagcagctgcaggaaatctggctgagcagctgcagg ID NO:5'

[0024] The base sequence of the specific repetitive sequence chr11-1 on chromosome 11 is: 5'-gtgccattgacacaggaggacctacgcctcagaaagacttttatctgagttaccaaggttgagatgttttgaaagatgctagatctgggaatctggctgagcagctgctgggacagctgggg ID NO: 6'(SEQ ID NO: 6).

[0025] Design a pair of common primers at the exact same base sequence sites on both sides of the specific repeat sequence chr21-2 of chromosome 21 and the specific repeat sequence chr11-1 of chromosome 11, such as figure 2 As shown, this primer pair can simultaneously amplify the specific repeat sequence of chromosome 21 chr21-2 and the specific repeat sequence of chromosome 11 chr11-1. In the primer pair:

[0026] Upstream primer (below chr 21-11 -F instead) is: 5'-gtgccattgacacaggaggac-3' (SEQ ID NO: 1);

[0027] Downstream primer (below chr 21-11 -R instead) is: 5'-ctttacccccagctgtccc-3' (SEQ ID NO: 2).

[0028] Taqman designed to specifically detect the specific repetitive sequence chr21-2 of chromosome 21 at the base difference between the specific repeat sequence chr21-2 of chromosome 21 and the specific repeat sequence chr11-1 of chromosome 11 The probe chr21-2-Probe and the Taqman probe chr11-1-Probe that specifically detects the specific repeat sequence of chromosome 11 chr11-1, such as figure 2 As shown, where:

[0029] The base sequence of the Taqman probe chr21-2-Probe is: 5'-ROX-agccagatttccacagcagatcca-BHQ1-3' (SEQ ID NO: 3);

[0030] The base sequence of the Taqman probe chr11-1-Probe is: 5'-HEX-tgctcagccagattcccagatcta-BHQ1-3' (SEQ ID NO: 4).

[0031] 1.2 Other components:

[0032] Hotstar-Taq enzyme, buffer, dATP, dTTP, dCTP and dGTP and Mg 2+ All were purchased from Beijing Kangwei Century Biotechnology Co., Ltd.

[0033] 2. Preparation of PCR reaction system:

[0034] Prepare the PCR reaction system according to the following table 1:

[0035] Table 1: (mM means mmol/L, μM means μmol/L)

[0036]

[0037] The PCR reaction system is 50uL.

[0038] 3. Source and processing of samples

[0039] The samples were derived from DNA samples whose karyotypes were determined by traditional karyotype analysis methods. The DNA samples were extracted by conventional laboratory DNA extraction methods, diluted with double-distilled water to 20ng/μL, and stored at -20°C for later use.

[0040] 4. PCR amplification program:

[0041] The instrument used in the PCR reaction is a CFX96 real-time fluorescent quantitative PCR instrument. The PCR reaction program is: 95°C pre-denaturation 10min; 95°C 15sec, 60°C 1min, 40 cycles, and fluorescence signal is collected at the end of the 60°C annealing step.

[0042] The normal specimen and the 21-trisomy specimen to be tested are amplified and tested on a fluorescent quantitative PCR machine according to the above reaction system and reaction procedure, and △CT is recorded respectively ROX Value and △CT HEX value.

[0043] 5. Result detection and analysis:

[0044] △CT of chromosome 21 and chromosome 11 of normal specimen 21-11 =Ct ROX -Ct HEX = -0.98, and the △CT of chromosome 21 and chromosome 11 of the 21-trisomy specimen 21-11 =Ct ROX -Ct HEX = -1.58; By comparing the △CT values of chromosome 21 and chromosome 11 normal specimens and 21-trisomy specimens: -0.98 and -1.58, the results show that chromosome 21 has one more copy than chromosome 11 (in theory, △ When the CT difference is 0.5, the copy difference is 1 copy), it can be seen that it is consistent with the result of chromosome karyotype analysis, and the tested trisomy 21 specimens are 3 chromosomes 21.

[0045] The experimental results show that the kit of the present invention can detect that the trisomy 21 specimen to be tested is trisomy 21, which is consistent with the result of traditional chromosome karyotype analysis. Therefore, the kit of the present invention can be used in clinical practice. Detection of specimens.

Example Embodiment

[0046] Example 2: Using the kits, methods, and procedures described in Example 1 to detect clinical specimens

[0047] The kit was used to test 35 normal specimens and 26 trisomy 21 specimens. All samples were derived from DNA samples whose karyotypes were determined by traditional karyotype analysis methods.

[0048] △CT through relative quantification of chromosome 21 and chromosome 11 21-11 Value (△CT 21-11 =Ct ROX -Ct HEX ), you can judge whether the specimen is a normal specimen or a 21-trisomy specimen. The real-time fluorescence quantitative detection △CT value and its range are as follows:

[0049] △CT of chromosome 21 and chromosome 11 of normal specimen 21-11 Value range is -0.98~-0.70; △CT of chromosome 21 and chromosome 11 of 21-trisomy specimen 21-11 The value range is -1.71~-1.39. The △CT value between the normal specimen and the 21-trisomy specimen has no cross overlap. The distribution of the △CT value in the interval is used to determine whether the test specimen is a normal specimen or 21-trisomy. Patient specimens.

[0050] The tested clinical normal karyotype specimens (the karyotype result is expressed as 46, NN, 46 means the number of normal chromosomes; NN means the normal sex chromosome) and the 21-trisomy karyotype specimen (the karyotype result is expressed as 47, NN , +21, 47 indicate the number of chromosomes, NN indicates a normal sex chromosome; +21 indicates an extra chromosome 21) The relative quantification of chromosome 21 and chromosome 11 △CT 21-11 The specific results of the values are shown in Table 2.

[0051] Table 2: ΔCT value results and analysis of multiple real-time fluorescence quantification of normal karyotype DNA and 21-trisomy karyotype DNA

[0052]

[0053]

[0054]

[0055] The experimental results show that the kit of the present invention can effectively and accurately detect the number of chromosome 21. The detection result is consistent with the traditional chromosome karyotype analysis method, the accuracy rate is 100%, the result is good in readability, analysis and detection The process is simple and efficient.

[0056]

[0057]

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine

Login to view more

PUM

Description & Claims & Application Information

We can also present the details of the Description, Claims and Application information to help users get a comprehensive understanding of the technical details of the patent, such as background art, summary of invention, brief description of drawings, description of embodiments, and other original content. On the other hand, users can also determine the specific scope of protection of the technology through the list of claims; as well as understand the changes in the life cycle of the technology with the presentation of the patent timeline. Login to view more.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine

Login to view more

Classification and recommendation of technical efficacy words

Ensure consistency
The test result is accurate

Kit used for detecting number of human chromosomes 21

A technology for the number of chromosomes and detection reagents, applied in the field of molecular biology, can solve the problems of DNA quality difference, inaccuracy of results, annealing temperature changes, etc.

AI-Extracted Technical Summary

Problems solved by technology

Abstract

Image

Examples

Example Embodiment

Example Embodiment

PUM

Description & Claims & Application Information

Similar technology patents

Method for manufacturing super-flat compact type chain vertical ring

Operating and maintenance system and parameter configuration method of network element device

Sorting and grouping method for power lead-acid storage battery set

River and lake layered synchronous rapid water collection device

Electric vehicle and power battery active temperature equalization system thereof

Classification and recommendation of technical efficacy words

Synchronous replication for system and data security

Soybean milk machine with small-space crushing cover

Tagged translation lookaside buffers in a hypervisor computing environment

Testing system for mobile terminal and testing method thereof

3D printing device and method

Fiberboard quality classification method based on machine vision

Non-contact tension detection and feedback control mesh belt winding device

Nondestructive testing method for optical glass polishing sub-surface damages

Image noisy point detection method based on convolution neural network

Memory device detecting method