Supercharge Your Innovation With Domain-Expert AI Agents!

Kit used for detecting number of human chromosomes 21

A technology for the number of chromosomes and detection reagents, applied in the field of molecular biology, can solve the problems of DNA quality difference, inaccuracy of results, annealing temperature changes, etc.

Inactive Publication Date: 2014-10-08
钦州市妇幼保健院
View PDF4 Cites 4 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, due to the use of two pairs of primers to amplify different fragments, very small changes in annealing temperature or differences in DNA quality will cause false negative or false positive results, resulting in inaccurate results (Helmy SM, Ismail S, Bassiouni R, et al.Sensitivity of DCSR3 / GAPDH ratio using quantitative real-time PCR in the rapid prenatal diagnosis for down syndrome[J].Fetal Diagn Ther,2009,25(2):220-223.)
[0005] The invention patents with the publication numbers CN100338227A and CN102086469A all disclose the method of detecting the number of chromosome 21 by designing different primers and probes for the specific sequences of different chromosomes. Changes in DNA quality or differences in DNA quality, which can cause false negative or false positive results

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Kit used for detecting number of human chromosomes 21
  • Kit used for detecting number of human chromosomes 21
  • Kit used for detecting number of human chromosomes 21

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0019] Embodiment 1: Using the kit of the present invention to detect normal specimens and specimens to be tested for trisomy 21

[0020] 1. The composition of the kit:

[0021] 1.1 Selection of target sequence and design of primers and probes

[0022] Detection sites: select the specific repetitive sequence chr21-2 on chromosome 21 and the specific repetitive sequence chr11-1 on chromosome 11 (chr21-2 and chr11-1 are two similar sequences) for relative real-time fluorescent quantitative PCR amplification and detection sequence, such as figure 1 shown, where:

[0023] The base sequence of the specific repetitive sequence chr21-2 on chromosome 21 is: 5'-gtgccattgacacaggaggacccatgcctgagaaagacttttatctgagttatactgagattaagatgttttgaagctcccaagcagagggatgctggatctgctgtggaaatctggctgagcagctgcagggacagctgggggtaaag-3' (SEQ ID NO: 5);

[0024] The base sequence of the specific repetitive sequence chr11-1 on chromosome 11 is: 5'-gtgccattgacacaggaggacctacgcctcagaaagacttttatctgagttaccaaggttgag...

Embodiment 2

[0046] Example 2: Using the kit, method, steps, etc. described in Example 1 to detect clinical samples

[0047] The kit was used to test 35 normal specimens and 26 trisomy 21 specimens, all of which were derived from DNA samples whose karyotypes were determined by traditional karyotype analysis methods.

[0048] Relative Quantification ΔCT by Chromosome 21 vs. Chromosome 11 21-11 Value (△CT 21-11 =Ct ROX -Ct HEX ), it can be judged whether the specimen is a normal specimen or a 21-trisomy specimen. The real-time fluorescence quantitative detection △CT value and its range are as follows:

[0049] △CT of chromosome 21 and chromosome 11 in normal specimen 21-11 The value ranges from -0.98 to -0.70; the △CT of chromosome 21 and chromosome 11 in trisomy 21 specimens 21-11 The value range is -1.71~-1.39, and the △CT value between the normal specimen and the 21-trisomy specimen has no overlap, and the distribution of the △CT value in the interval range can be used to judge wheth...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a kit used for detecting the number of human chromosomes 21. The kit comprises an amplification detection reagent, wherein the amplification detection reagent comprises a primer pair used for simultaneously amplifying specific repetitive sequences of chromosomes 21 and specific repetitive sequences of chromosomes 11, a fluorescent probe used for specifically detecting the specific repetitive sequences of the chromosomes 21 and a fluorescent probe used for specifically detecting the specific repetitive sequences of the chromosomes 11. The kit has the beneficial effects that the kit adopts a pair of primers to simultaneously amplify a pair of similar sequences between different chromosomes, thus avoiding mutual interference or other interferences caused by amplifying different sequences by different primers and ensuring the consistency of the amplification efficiency; the fluorescent probes are selectively designed in the DNA sequence sites with base difference so that the amplification volumes of two sequences can be respectively detected accurately via deltaCT values of real-time fluorescent PCR (polymerase chain reaction) of repeat segments, thus further improving the accuracy and reliability of the detection results and reducing the probability of causing false negative or false positive results.

Description

technical field [0001] The invention relates to a kit for detecting the number of human chromosome 21, which belongs to the field of molecular biology. Background technique [0002] Down syndrome (Down's syndrome), also known as trisomy 21, is the most common aneuploidy disease caused by abnormal chromosome number in humans, and the incidence rate of newborns is 1 / 600-1 / 800. The main manifestations of the children are severe congenital mental retardation and congenital malformations of various organs, and most patients cannot take care of themselves. At present, there is no effective treatment for this disease. Therefore, prenatal diagnosis to prevent the birth of children is the main method to prevent the occurrence of such diseases. For a long time, amniotic fluid cell culture and chromosomal karyotype analysis have become the classic methods of prenatal diagnosis (Caspersson T, Zech L, Johansson C, et al. Identification of human chromosomes by DNA-binding fluorescent age...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12Q1/68
CPCC12Q1/686C12Q2561/101C12Q2563/107
Inventor 孙雷翁勋锦叶学和唐维骏樊祖茜龙驹
Owner 钦州市妇幼保健院
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More