Kit used for detecting number of human chromosomes 21
A technology for the number of chromosomes and detection reagents, applied in the field of molecular biology, can solve the problems of DNA quality difference, inaccuracy of results, annealing temperature changes, etc.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Example Embodiment
[0019] Example 1: Using the kit of the present invention to detect normal samples and 21-trisomy samples to be tested
[0020] 1. The composition of the kit:
[0021] 1.1 Selection of target sequence and design of primers and probes
[0022] Detection site: Select the specific repetitive sequence chr21-2 on chromosome 21 and the specific repetitive sequence chr11-1 on chromosome 11 (chr21-2 and chr11-1 are two similar sequences) as relative real-time fluorescent quantitative PCR amplification and Detection sequence, such as figure 1 As shown, where:
[0023] The base sequence of the specific repetitive sequence chr21-2 on chromosome 21 is: 5'-gtgccattgacacaggaggacccatgcctgagaaagacttttatctgagttactgagattaagatgttttgaagctcccaagcagagggatgctggatctgctgtggaaatctggctggctgagcagctgcaggaaatctggctgagcagctgcaggaaatctggctgagcagctgcagg ID NO:5'
[0024] The base sequence of the specific repetitive sequence chr11-1 on chromosome 11 is: 5'-gtgccattgacacaggaggacctacgcctcagaaagacttttatctgagttaccaaggttgag...
Example Embodiment
[0046] Example 2: Using the kits, methods, and procedures described in Example 1 to detect clinical specimens
[0047] The kit was used to test 35 normal specimens and 26 trisomy 21 specimens. All samples were derived from DNA samples whose karyotypes were determined by traditional karyotype analysis methods.
[0048] △CT through relative quantification of chromosome 21 and chromosome 11 21-11 Value (△CT 21-11 =Ct ROX -Ct HEX ), you can judge whether the specimen is a normal specimen or a 21-trisomy specimen. The real-time fluorescence quantitative detection △CT value and its range are as follows:
[0049] △CT of chromosome 21 and chromosome 11 of normal specimen 21-11 Value range is -0.98~-0.70; △CT of chromosome 21 and chromosome 11 of 21-trisomy specimen 21-11 The value range is -1.71~-1.39. The △CT value between the normal specimen and the 21-trisomy specimen has no cross overlap. The distribution of the △CT value in the interval is used to determine whether the test specimen is ...
PUM
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap