Unlock instant, AI-driven research and patent intelligence for your innovation.

Kit for quickly detecting number of human chromosomes 21 by multiplex real-time fluorescence quantitative PCR (polymerase chain reaction) technique

A real-time fluorescence quantitative, chromosome number technology, applied in the field of molecular biology, can solve the problems of DNA quality difference, inaccurate results, annealing temperature changes, etc., to achieve high sensitivity, specificity, quick and easy, and ensure consistency.

Inactive Publication Date: 2014-10-08
钦州市妇幼保健院
View PDF7 Cites 6 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, due to the use of two pairs of primers to amplify different fragments, very small changes in annealing temperature or differences in DNA quality will cause false negative or false positive results, resulting in inaccurate results (Helmy SM, Ismail S, Bassiouni R, et al.Sensitivity of DCSR3 / GAPDH ratio using quantitative real-time PCR in the rapid prenatal diagnosis for down syndrome[J].Fetal Diagn Ther,2009,25(2):220-223.)
[0005] The invention patents with the publication numbers CN100338227A and CN102086469A all disclose the method of detecting the number of chromosome 21 by designing different primers and probes for the specific sequences of different chromosomes. Changes in DNA quality or differences in DNA quality, which can cause false negative or false positive results
On the other hand, there is only one detection site in the above methods, and when a gene mutation occurs in the genome complementary sequence of the primer, it may also cause false negative or false positive experimental results.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Kit for quickly detecting number of human chromosomes 21 by multiplex real-time fluorescence quantitative PCR (polymerase chain reaction) technique
  • Kit for quickly detecting number of human chromosomes 21 by multiplex real-time fluorescence quantitative PCR (polymerase chain reaction) technique
  • Kit for quickly detecting number of human chromosomes 21 by multiplex real-time fluorescence quantitative PCR (polymerase chain reaction) technique

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0025] Embodiment 1: Using the kit of the present invention to detect normal specimens and specimens to be tested for trisomy 21

[0026] 1. The composition of the kit:

[0027] 1.1 Selection of target sequence and design of primers and probes

[0028] 1) The first independent detection site: select the specific repetitive sequence chr21-1 on chromosome 21 and the specific repetitive sequence chr6-1 on chromosome 6 (chr21-1 and chr6-1 are two similar sequences) as relatively real-time Real-time quantitative PCR amplification and detection sequence, such as figure 1 shown, where:

[0029] The base sequence of the specific repetitive sequence chr21-1 on chromosome 21 is: 5'-acaggacctgaccctggctcccggccagcctcacctcccatggctttcctgcccctgtatt acctcacttccttcccctttagccatccttcgggcctcagttcaagttcacatcttcaggatggt-3' (SEQ ID NO: 9);

[0030] The base sequence of the specific repetitive sequence chr6-1 on chromosome 6 is: 5'-acaggacctgaccctggctcccggccagcctcatctcccatggctttcctgtccctgtact acctc...

Embodiment 2

[0065] Example 2: Using the kit, method, steps, etc. described in Example 1 to detect clinical samples

[0066] The kit was used to test 35 normal specimens and 26 trisomy 21 specimens, all of which were derived from DNA samples whose karyotypes were determined by traditional karyotype analysis methods.

[0067] Relative Quantification ΔCT by Chromosome 21 vs. Chromosome 6 21-6 Value (△CT 21-6 =Ct CY5 -Ct FAM ), and the relative quantitative ΔCT of chromosome 21 and chromosome 11 21-11 Value (△CT 21-11 Value = Ct ROX -Ct HEX ), it can be judged whether the specimen is a normal specimen or a 21-trisomy specimen. The real-time fluorescence quantitative detection △CT value and its range are as follows:

[0068] △CT of chromosome 21 and chromosome 6 in normal specimen 21-6 The value ranges from 0.23 to 0.65; the △CT of chromosome 21 and chromosome 6 in trisomy 21 specimens 21-6 The value range is -0.32~-0.05, and the △CT value between the normal specimen and the 21-trisom...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a kit for quickly detecting the number of human chromosomes 21 by a multiplex real-time fluorescence quantitative PCR (polymerase chain reaction) technique, which comprises amplification detection reagents, the amplification detection reagents comprise a pair of primers capable of simultaneously amplifying a certain specific repetitive sequence on the chromosome 21 and a specific repetitive sequence on the chromosome 6, two fluorescent probes for respectively detecting the amplification quantities of the specific repetitive sequences of the chromosomes 21 and 6, a pair of primers capable of simultaneously amplifying another specific repetitive sequence on the chromosome 21 and a specific repetitive sequence on the chromosome 11, and two fluorescent probes for respectively detecting the amplification quantities of the specific repetitive sequences of the chromosomes 21 and 11. The kit can determine the detection result according to Delta CT21-6 value of the chromosomes 21 and 6 and the Delta CT21-11 value of the chromosomes 21 and 11; and the two Delta CT values can be used for independently detecting the number of the chromosomes 21, and the result is more reliable.

Description

technical field [0001] The invention relates to a kit for rapidly detecting the number of human chromosome 21 by multiple real-time fluorescent quantitative PCR technology, which belongs to the field of molecular biology. Background technique [0002] Down syndrome (Down's syndrome), also known as trisomy 21, is the most common aneuploidy disease caused by abnormal chromosome number in humans, and the incidence rate of newborns is 1 / 600-1 / 800. The main manifestations of the children are severe congenital mental retardation and congenital malformations of various organs, and most patients cannot take care of themselves. At present, there is no effective treatment for this disease. Therefore, prenatal diagnosis to prevent the birth of children is the main method to prevent the occurrence of such diseases. For a long time, amniotic fluid cell culture and chromosomal karyotype analysis have become the classic methods of prenatal diagnosis (Caspersson T, Zech L, Johansson C, et ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12Q1/68
CPCC12Q1/6851C12Q2531/113C12Q2537/143C12Q2561/101
Inventor 孙雷樊祖茜龙驹
Owner 钦州市妇幼保健院