Thyroid hormone receptor (TR) alpha gene serving as goat growth trait genetic marker and application
A technology of growth traits and genetic markers, applied in the field of molecular marker preparation of goats, can solve the problem of unseen TRα gene polymorphism
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0020] Example 1: Goat TRα Acquisition of gene fragments and polymorphism detection
[0021] Use NCBI database information to compare cattle and sheep online TRα Gene, designed primers to amplify goat in the conserved region of exons 6 and 7 TRα Intron 6 of the gene. Forward primer: 5' GCCTTCAGCGAGTTTACCAA 3', reverse primer: 5' CTTCCGTGTCATCCAGGTTA 3'.
[0022] Select 6 genomic DNA samples (3 Nanjiang yellow sheep and 3 Tibetan goats each), use their genomic DNA as a template, and use the above-mentioned primers to carry out PCR reaction. Reaction system: 2×Master Mix Taq enzyme 25 μL, cDNA 4 μL, upstream primer (10 μM) 1.5 μL, downstream primer (10 μM) 1.5 μL, ddH2O 18 μL. PCR reaction program: pre-denaturation at 95°C for 5min; then denaturation at 94°C for 30s, annealing at 61.2°C for 30s, extension at 72°C for 45s, cycle 35 times; finally extension at 72°C for 10min. Take 4 μL of the product, detect it by agarose gel electrophoresis, and send the PCR product contai...
Embodiment 2
[0023] Example 2: Polymorphic distribution of molecular markers in different goat populations
[0024] The detection found that the C230T locus had two genotypes CC and CT in the three breeds of Nanjiang yellow sheep, Inner Mongolia cashmere goat and Tibetan goat, and the CC genotype was the dominant genotype. This locus is in the Hardy-Weinberg equilibrium state in the three breeds, and it is in low-density polymorphism (PIC<0.25) in southern Xinjiang gazelle and Inner Mongolia cashmere goat, and in moderate polymorphism (0.25< PIC<0.5). As shown in the following table:
[0025] Table 1 Three goat breeds TRα Genotype (allele) frequency and genetic characteristics of gene C230T locus
[0026]
Embodiment 3
[0027] Example 3: Application of Molecular Markers in Production Traits
[0028] for the establishment TRα The relationship between gene molecular markers and goat phenotype, 124 Nanjiang yellow sheep (Nanjiang Yellow Goat Breeding Farm, Nanjiang County, Sichuan Province) were selected as test materials. The test population was detected by the polymorphism detection method established in Example 1. The GLM process of SAS v8.0 software was used to carry out the correlation analysis between the C230T variant site and the measured values of growth traits of Nanjiang Yellow sheep, and the results were expressed in LSM±standard error.
[0029]For the population of Nanjiang yellow sheep (124 individuals), the linear model was used to analyze the growth traits such as body weight, body length, body height, bust, and birth weight of different genotypes of the TRα gene C230T site and different growth stages. Mainly: Y ijkl = mu ijkl + S i + B j + G k + S i x B j + ...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 
