Thyroid hormone receptor (TR) alpha gene serving as goat growth trait genetic marker and application

A technology of growth traits and genetic markers, applied in the field of molecular marker preparation of goats, can solve the problem of unseen TRα gene polymorphism

Inactive Publication Date: 2014-10-15
SICHUAN AGRI UNIV
View PDF0 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

The research results of Helena et al. found that in the 2nd exon, the 3rd intron, the 5th exon, the 8th intron, the 3'UTR region of the 9th exon, the 10th exon of the human TRα gene SNPs were found in the 3'UTR region of goats (Sorensen, van der Deure et al. 2008), but TRα gene polymorphisms have not been reported in goats

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Thyroid hormone receptor (TR) alpha gene serving as goat growth trait genetic marker and application
  • Thyroid hormone receptor (TR) alpha gene serving as goat growth trait genetic marker and application
  • Thyroid hormone receptor (TR) alpha gene serving as goat growth trait genetic marker and application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0020] Example 1: Goat TRα Acquisition of gene fragments and polymorphism detection

[0021] Use NCBI database information to compare cattle and sheep online TRα Gene, designed primers to amplify goat in the conserved region of exons 6 and 7 TRα Intron 6 of the gene. Forward primer: 5' GCCTTCAGCGAGTTTACCAA 3', reverse primer: 5' CTTCCGTGTCATCCAGGTTA 3'.

[0022] Select 6 genomic DNA samples (3 Nanjiang yellow sheep and 3 Tibetan goats each), use their genomic DNA as a template, and use the above-mentioned primers to carry out PCR reaction. Reaction system: 2×Master Mix Taq enzyme 25 μL, cDNA 4 μL, upstream primer (10 μM) 1.5 μL, downstream primer (10 μM) 1.5 μL, ddH2O 18 μL. PCR reaction program: pre-denaturation at 95°C for 5min; then denaturation at 94°C for 30s, annealing at 61.2°C for 30s, extension at 72°C for 45s, cycle 35 times; finally extension at 72°C for 10min. Take 4 μL of the product, detect it by agarose gel electrophoresis, and send the PCR product contai...

Embodiment 2

[0023] Example 2: Polymorphic distribution of molecular markers in different goat populations

[0024] The detection found that the C230T locus had two genotypes CC and CT in the three breeds of Nanjiang yellow sheep, Inner Mongolia cashmere goat and Tibetan goat, and the CC genotype was the dominant genotype. This locus is in the Hardy-Weinberg equilibrium state in the three breeds, and it is in low-density polymorphism (PIC<0.25) in southern Xinjiang gazelle and Inner Mongolia cashmere goat, and in moderate polymorphism (0.25< PIC<0.5). As shown in the following table:

[0025] Table 1 Three goat breeds TRα Genotype (allele) frequency and genetic characteristics of gene C230T locus

[0026]

Embodiment 3

[0027] Example 3: Application of Molecular Markers in Production Traits

[0028] for the establishment TRα The relationship between gene molecular markers and goat phenotype, 124 Nanjiang yellow sheep (Nanjiang Yellow Goat Breeding Farm, Nanjiang County, Sichuan Province) were selected as test materials. The test population was detected by the polymorphism detection method established in Example 1. The GLM process of SAS v8.0 software was used to carry out the correlation analysis between the C230T variant site and the measured values ​​of growth traits of Nanjiang Yellow sheep, and the results were expressed in LSM±standard error.

[0029]For the population of Nanjiang yellow sheep (124 individuals), the linear model was used to analyze the growth traits such as body weight, body length, body height, bust, and birth weight of different genotypes of the TRα gene C230T site and different growth stages. Mainly: Y ijkl = mu ijkl + S i + B j + G k + S i x B j + ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

Belonging to the technical field of goat genetic marker preparation, the invention in particular relates to a molecular marker related to goat growth traits and application thereof. The molecular marker is obtained by cloning of a sixth intron sequence of a goat TR alpha gene, and the nucleotide sequence of the gene is shown as a sequence table SEQ ID NO:1. Base mutation of C230-T230 occurs at a 230th base of the sequence shown as the sequence table SEQ ID NO:1, and results in NdeI-RFLP polymorphism. The invention also discloses a preparation method of the molecular marker and application of a polymorphic detection method, and provides a new genetic marker for marker assisted selection of goat.

Description

technical field [0001] The invention belongs to the technical field of goat molecular marker preparation, mainly for goat TRα The cloning of the gene and its use as molecular marker-assisted selection, that is, the use of the C230T mutation site located in the sixth intron of the gene to predict the growth traits of different genotypes of goats. Background technique [0002] Traditional livestock breeding is based on some phenotypic traits, but these phenotypic traits are jointly determined by genetic genes and the external environment, so traditional breeding cannot play a decisive role in the breeding of many excellent traits. In addition, certain traits need to be measured after sexual maturity or growth, requiring longer periods. The use of molecular genetics methods, such as SNP markers and microsatellite markers, can essentially change the traits and overcome the shortcomings of traditional breeding. Molecular genetics method can obtain data at an early stage, which ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12N15/12C12N15/10C12Q1/68
Inventor王林杰张红平李利仲涛王艳薛科周中强
OwnerSICHUAN AGRI UNIV