Thyroid Hormone Receptor α Gene as Genetic Marker for Goat Growth Traits and Its Application

A growth trait, α gene technology, applied in the application, genetic engineering, plant genetic improvement and other directions, can solve problems such as unseen TRα gene polymorphism

A growth trait, α gene technology, applied in the application, genetic engineering, plant genetic improvement and other directions, can solve problems such as unseen TRα gene polymorphism

CN104099336BInactive Publication Date: 2016-05-11SICHUAN AGRI UNIV

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Thyroid Hormone Receptor α Gene as Genetic Marker for Goat Growth Traits and Its Application
  • Thyroid Hormone Receptor α Gene as Genetic Marker for Goat Growth Traits and Its Application
  • Thyroid Hormone Receptor α Gene as Genetic Marker for Goat Growth Traits and Its Application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0019] Example 1: Obtaining and Polymorphism Detection of Goat TRα Gene Fragment

[0020] Utilizing the NCBI database information, the bovine and sheep TRα genes were compared online, and primers were designed to amplify the sixth intron of the goat TRα gene in the conserved region of exons 6 and 7. Forward primer: 5'GCCTTCAGCGAGTTTACCAA3', reverse primer: 5'CTTCCGTGTCATCCAGGTTA3'.

[0021] Select 6 genomic DNA samples (3 Nanjiang yellow sheep and 3 Tibetan goats each), use their genomic DNA as a template, and use the above-mentioned primers to carry out PCR reaction. Reaction system: 2×MasterMixTaq enzyme 25 μL, cDNA 4 μL, upstream primer (10 μM) 1.5 μL, downstream primer (10 μM) 1.5 μL, ddH2O 18 μL. PCR reaction program: pre-denaturation at 95°C for 5 min; then denaturation at 94°C for 30 s, annealing at 61.2°C for 30 s, extension at 72°C for 45 s, and 35 cycles; finally, extension at 72°C for 10 min. Take 4 μL of the product, detect it by agarose gel electrophoresis, and ...

Embodiment 2

[0022] Example 2: Polymorphic distribution of molecular markers in different goat populations

[0023] The detection found that the C230T loci had two genotypes CC and CT in the three breeds of Nanjiang yellow sheep, Inner Mongolia cashmere goat and Tibetan goat, and the CC genotype was the dominant genotype. This locus is in the Hardy-Weinberg equilibrium state in the three breeds, and it is in low-density polymorphism (PIC<0.25) in southern Xinjiang gazelle and Inner Mongolia cashmere goat, and in moderate polymorphism (0.25< PIC<0.5). As shown in the following table:

[0024] Table 1 The genotype (allele) frequency and genetic characteristics of TRα gene C230T locus in three goat breeds

[0025]

Embodiment 3

[0026] Example 3: Application of Molecular Markers in Production Traits

[0027] In order to establish the relationship between molecular markers of TRα gene and goat phenotype, 124 Nanjiang yellow sheep (Nanjiang Yellow Goat Breeding Farm, Nanjiang County, Sichuan Province) were selected as experimental materials. The test population was detected by the polymorphism detection method established in Example 1. The GLM process of SASv8.0 software was used to analyze the correlation between the C230T mutation site and the measured values ​​of growth traits of Nanjiang Yellow sheep, and the results were expressed in LSM±standard error.

[0028] For the population of Nanjiang yellow sheep (124 individuals), the linear model was used to analyze the growth traits such as body weight, body length, body height, bust and newborn weight of different genotypes at the C230T site of TRα gene and different growth stages. Mainly: Y ijkl =μ ijkl +S i +B j +G k +S i ×B j +e ijkl , wher...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

Belonging to the technical field of goat genetic marker preparation, the invention in particular relates to a molecular marker related to goat growth traits and application thereof. The molecular marker is obtained by cloning of a sixth intron sequence of a goat TR alpha gene, and the nucleotide sequence of the gene is shown as a sequence table SEQ ID NO:1. Base mutation of C230-T230 occurs at a 230th base of the sequence shown as the sequence table SEQ ID NO:1, and results in NdeI-RFLP polymorphism. The invention also discloses a preparation method of the molecular marker and application of a polymorphic detection method, and provides a new genetic marker for marker assisted selection of goat.

Description

technical field [0001] The invention belongs to the technical field of goat molecular marker preparation, mainly for the cloning of goat TRα gene and as a molecular marker-assisted selection, that is, using the C230T variation site located in the sixth intron of the gene to predict the growth of goat individuals with different genotypes traits. Background technique [0002] Traditional livestock breeding is based on some phenotypic traits, but these phenotypic traits are jointly determined by genetic genes and the external environment, so traditional breeding cannot play a decisive role in the breeding of many excellent traits. In addition, certain traits need to be measured after sexual maturity or growth, requiring longer periods. The use of molecular genetics methods, such as SNP markers and microsatellite markers, can essentially change the traits and overcome the shortcomings of traditional breeding. Molecular genetics method can obtain data at an early stage, which i...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
11 May 2016
Publication
CN104099336B
IPC
C12N15/12; C12N15/10; C12Q1/68
Inventors
王林杰; 张红平