Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Six2 genetic expression-inhibiting shRNA, lentiviral expression vector and construction method of lentiviral expression vector

A technology of lentiviral vector and gene expression, applied in the field of shRNA, lentiviral expression vector and its construction

Inactive Publication Date: 2014-12-10
XUZHOU MEDICAL COLLEGE
View PDF0 Cites 12 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

During kidney development, Six2 can directly bind to the GDNF promoter region to promote the expression of GDNF. It has not been reported whether Six2 can also promote the expression of GDNF in the early stage of 6-OHDA injury.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Six2 genetic expression-inhibiting shRNA, lentiviral expression vector and construction method of lentiviral expression vector
  • Six2 genetic expression-inhibiting shRNA, lentiviral expression vector and construction method of lentiviral expression vector
  • Six2 genetic expression-inhibiting shRNA, lentiviral expression vector and construction method of lentiviral expression vector

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0034] Design and entrust Shanghai Sangon Bioengineering Co., Ltd. to synthesize the interference sequences targeting Six2 as follows:

[0035] shSix2-1:Forward:5'-GATCCG CCAAGGAAAGGGAGAACAA TTCAAGAGATTGAACTCCCTTTCCTTGGTTTTTCG-3' (SEQ ID NO. 1);

[0036] shSix2-2:Forward:5'-GATCCG GCTACTGCTTCAAGGAAAA TTCAAGAGATTTTCCTTGAAGCAGTAGCTTTTTCG-3' (SEQ ID NO. 2);

[0037] shSix2-3:Forward:5'-GATCCG GAATGAAAGCGTGCTCAA TTCAAGAGATTGAGCACGCTTTTCATTCTTTTTTCG-3' (SEQ ID NO. 3);

[0038] shSix2-4:Forward:5’-GATCCG CAGCCAACCTCGTGGACCT TTCAAGAGAAGGTCCACGAGGTTGGCTGTTTTTCG-3' (SEQ ID NO. 4);

[0039] shSix2-5:Forward:5'-GATCCG GCAACTTCCGCGAGCTCTA TTCAAGAGATAGAGCTCGCGGAAGTTGCTTTTTCG-3' (SEQ ID NO. 5).

[0040] Control group Forward:: 5’GATCCG GCAAGCTGACCCTGAAGTTCA TTTCAAGAGAATGAACTTCAGGGTCAGCTTGCTTTTTCG-3' (SEQ ID NO. 6).

[0041]The synthesized sequence was annealed to form double strands, and the carrier plasmid pLVX-EF1α-IRES-Puro digested with BamH I and EcoR I was used for liga...

Embodiment 2

[0043] Example 2 Packaging of lentivirus pLV-shSix2

[0044] 293T cells were cultured in DMEM medium containing 10% FBS, and virus transfection was performed when the cell density grew to about 60%. The vector plasmids and packaging plasmids pLP1 and pLP / VSVG (purchased from Clontech Company) that were successfully connected with the knockdown sequence were used Lipofectamine TM 2000 was transfected into 293T cells; the cell culture medium was collected on the 3rd day after transfection, and replaced with fresh medium; the cell culture medium was collected again on the 4th day, and the supernatants collected twice were mixed. Centrifuge the above medium at 1000 rpm for 5 min, discard the cell debris, and filter the supernatant into a 50 ml centrifuge tube using a PVDF filter with a pore size of 0.45 μm. Centrifuge again (4°C, 50 000rpm high-speed centrifugation), carefully discard the supernatant and dry it, add 100ul / 10cm culture dish to resuspend the virus pellet in DMEM (n...

Embodiment 3

[0045] Example 3 Determination of biological titer of lentivirus pLV-shSix2

[0046] Because the packaged virus does not contain luminescent protein, during the experiment, under the same experimental conditions, we packaged the lentivirus pLV-GFP carrying the GFP gene at the same time, and used this virus to measure the titer of the virus , and to verify the success of the virus infection. One day before titer determination, take a 96-well plate, according to 1×10 per well 5 The density of cells to inoculate 293T cells. Add polybrene to fresh complete medium to a final concentration of 8 μg / ml. Dilute the virus in a 10-fold gradient with a complete medium containing polybrene; pipette 10 μl of the virus dilution into the corresponding 96-well plate and place at 37°C, 5% CO 2 Cultivate in the incubator overnight, replace the medium with fresh complete medium after 8 hours, continue to cultivate in the incubator for 96 hours, and count the number of fluorescent cells with a ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a Six2 genetic expression-inhibiting shRNA, a lentiviral expression vector and a construction method of the lentiviral expression vector. The Six2 genetic expression-inhibiting shRNA has a sequence of SEQ ID NO.2. The Six2 gene shRNA knockout lentiviral expression vector is obtained by inserting the shRNA into BamH I and EcoR I digestion sites of a vector plasmid pLVX-EF1alpha-IRES-Puro. The lentivirus pLV-shSix2 is obtained by transfecting the lentiviral vector plasmid and a packaging plasmid pLP1 and pLP / VSVG with a 293T cell. The screened shRNA which has a remarkable inhibiting effect on the Six2 genetic expression, and on the basis, the lentiviral expression vector and lentiviral, from which Six2 is knocked out, are successfully constructed, and a MES23.5 cell strain from which the Six2 gene is stably knocked out is obtained, thereby laying a good foundation for further researching the function of the Six2.

Description

technical field [0001] The invention belongs to the field of biotechnology, and relates to shRNA, a lentiviral expression vector and a construction method thereof for inhibiting Six2 gene expression. Background technique [0002] Parkinson's disease is a common degenerative disease of the nervous system in middle-aged and elderly people, and the incidence rate of people over 50 years old is about 1%-2%. The etiology and pathogenesis of the disease have not yet been fully elucidated, and its pathological changes are mainly manifested in the chronic progressive loss of DA neurons in the substantia nigra of the midbrain. GDNF has a good protective effect on DA neurons. However, exogenous GDNF is difficult to pass through the blood-brain barrier. Nerve cells have great application prospects. [0003] Transcription factor Six2 is a member of the Six homeobox family, and members of this family have three domains: the amino-terminal domain is mainly involved in nuclear localizati...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/113C12N15/867C12N15/66C12N7/00C12N5/07
Inventor 高锦高殿帅亢小玉李俐孙申张宝乐李亨姚瑞芹
Owner XUZHOU MEDICAL COLLEGE
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com