Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Method for preparing beta-alanine through enzymatically catalyzing hydrolysis of high-concentration beta-aminopropionitrile

An aminopropionitrile, high-concentration technology, applied in fermentation and other directions, can solve the problems of low substrate concentration and difficulty in industrialization, and achieve the effect of reducing ammonia emissions

Active Publication Date: 2014-12-10
TIANJIN INST OF IND BIOTECH CHINESE ACADEMY OF SCI
View PDF5 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0004] The currently reported method of using microorganisms to catalyze the hydrolysis of β-aminopropionitrile to generate β-alanine has a low substrate concentration and is difficult to achieve industrialization

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for preparing beta-alanine through enzymatically catalyzing hydrolysis of high-concentration beta-aminopropionitrile

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0018] Embodiment 1: the acquisition of highly expressed genetically engineered bacteria

[0019] Design upstream primer (5'-3') TCGCATATGATGGATAGCAACCGACCG, downstream primer (5'-3') TTTGGATCCTCAATTGCGCGCGCGAACG, from Bradyrhizobium japonicum Amplify the blr3397 gene in USDA110, construct the PTXB1 (restriction site Nde I, BamH I) plasmid, introduce the recombinant plasmid into the host bacteria, and ferment and cultivate the engineering bacteria to realize the efficient heterologous expression of nitrilase. Escherichia coli BL21, Rosetta or Origami were selected to screen genetically engineered bacteria with soluble nitrilase in the bacteria, among which the target protein expression of the recombinant bacteria with Escherichia coli Rosetta (DE3) as the host bacteria was relatively good. The engineering bacteria whose expression level of the target protein is not less than 20% shall be used as the engineering bacteria strains for production, and shall be preserved in the...

Embodiment 3

[0022] Implementation example 3 Utilize resting cell blr3397 to catalyze the single hydrolysis of β-aminopropionitrile

[0023] Take 3.5 g of blr3397 resting cells and resuspend them in 30 mL of aqueous solution (6.0 g, 2.5 M) adjusted to pH 7.5 with 6.0 g of β-aminopropionitrile (6.0 g, 2.5 M) after adding 6.0 g of β-aminopropionitrile. After reacting for 5 hours, HPLC detection showed that the reaction was complete (FDAA derivative, mobile phase triethylamine: acetonitrile: 62.5:37.5), the product was purified into a strong cation exchange resin, and 1 M hydrochloric acid was used to slowly flow through the resin, and the dosage was about 2% of the resin volume. -3 times, 1.5 times the bed volume per hour; rinse with water and the pH of the water is about 4.0; use 1 M NaOH to flow through the resin, the dosage and flow rate are the same as 1; wash with water until the pH of the water is about 10.0; use 1M hydrochloric acid to Resin to H + Type, the dosage is 3-5 times the...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to a method for preparing beta-alanine through enzymatically catalyzing hydrolysis of high-concentration beta-aminopropionitrile. More specifically, the invention provides a hydrolyzing high-concentration beta-aminopropionitrile by utilizing nitrilase and genetically engineered bacteria thereof or combining together with aspartic acid lyase and genetically engineered bacteria thereof, and the beta-alanine is widely applied to synthesis of pantothenic acid, calcium pantothenate, carnosine, Pamidronate, balsalazine and other medical or feed and food additives. The method has the significant characteristics of being high in substrate concentration, mild in reaction conditions, pollution-free, simple in process route, and the like.

Description

technical field [0001] The invention belongs to the fields of biocatalytic preparation of pharmaceutical intermediates and green chemistry, and relates to the preparation of β-aminopropionitrile by using nitrilase genetically engineered bacteria, cultures, or processed products or combined with aspartate ammonia lyase to catalyze high-concentration β-aminopropionitrile hydrolysis. Alanine method. Background technique [0002] β-alanine is widely used in the synthesis of pantothenic acid and calcium pantothenate, carnosine, sodium pamidronate, balsalazide and other medicines or feed and food additives. The way to obtain β-alanine can be obtained by hydrolyzing and refining sericin, gelatin, zein and other substances, but the source of raw materials is limited and the cost is high. At present, the industry is mainly produced by chemical methods, but the chemical synthesis method requires strong acid or strong base to participate in the reaction, which requires high equipment ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12P13/06C12P13/20
Inventor 姚培圆吴洽庆袁京韩超冯进辉朱敦明马延和
Owner TIANJIN INST OF IND BIOTECH CHINESE ACADEMY OF SCI
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com