Novel promoter and use thereof

A promoter and nucleotide sequence technology, applied in the direction of activity regulation, introduction of foreign genetic material using vectors, biofuels, etc., can solve the problems of insufficient expression level of downstream genes, achieve excellent productivity, increase productivity, and improve expression level Effect

Inactive Publication Date: 2014-12-17
TOYOTA JIDOSHA KK +1
View PDF2 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0005] Although the above different promoters can always cause high expression of genes located downstream thereof in commonly available yeasts such as Saccharomyces cerevisiae, when thermotolerant yeasts are used as hosts, the expression level of such downstream genes is insufficient

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Novel promoter and use thereof
  • Novel promoter and use thereof
  • Novel promoter and use thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0079] In this example, the PIR1 gene promoter and the CTR1 gene promoter in Kluyveromyces marxii, which is a thermotolerant yeast, were isolated and evaluated for promoter activity by a reporter assay method.

[0080] First, chromosomal DNA of K. marxii was prepared according to standard methods. Using the obtained chromosomal DNA as a template, KmCTR1-1085 (TAGGATCAGGAGACAATCGATATTA (SEQ ID NO: 3)) and CLuc+30c-KmCTR1-1c2

[0081] (caaagcgacagccaagatcaaggtcttcatCTTGATTGTTCAATTGTCAATTGTC (SEQ ID NO: 4)) as a primer, and KOD plus DNA polymerase (Toyobo), PCR was performed. After PCR is completed, the reaction solution is subjected to electrophoresis to obtain the target DNA band.

[0082] In addition, chromosomal DNA of Saccharomyces cerevisiae RAK4296 strain (MATa his3 200leu2 0met15 0trp1-delta-63ura3 0::ScGAL10p-yCLuc-15C-LEU2) was prepared according to a standard method. Using the obtained chromosomal DNA as a template, yCLuc+1 (ATGAAGACCTTGATCTTGGC (SEQ ID NO: 5)) and U...

Embodiment 2

[0099] In this example, the PIR1 promoter of Kluyveromyces marxii and the CTR1 promoter of Kluyveromyces markeks evaluated in Example 1 were examined in terms of functional regions.

[0100] Specifically, PCR was performed using the chromosomal DNA of the RAK5689 strain prepared in Example 1 as a template, the URA3-280c ​​primer, and each of the primers listed in Table 2. That is, as a result of PCR, DNA fragments each containing a luciferase gene having a different characteristic from that obtained by cutting the PIR1 promoter evaluated in Example 1 on the 5' terminal side were synthesized. One of the DNA fragments of different lengths is fused. Each PCR-amplified fragment was introduced into K. marxense strain RAK4174, and luciferase activity was measured as described in Example 1.

[0101] [Table 2]

[0102] KmPIR1-2867

[0103] image 3 Displays the length of the DNA fragment evaluated and the luciferase activity measurement. Such as image 3 As shown in , i...

Embodiment 3

[0109] In this example, the PIR1 promoter and the CTR1 promoter of Kluyveromyces marxii evaluated in Example 1 were used as promoters for introducing foreign genes into thermotolerant yeast to evaluate their activation child activity.

[0110][Generation of xyl1 / xyl2 double deletion mutant transfected with XI gene]

[0111] The xyl2 gene used to delete the RAK6163xyl1 deletion strain (xyl1::ScURA3,leu2,his3) from the Kluyveromyces marxense strain DMKU3-1042 (also called "RRAK35966") was prepared as described below and simultaneously introduced xylose isomer Carrier of the enzyme (XI) gene. The XI gene used herein is the RsXI-C1-opt (hereinafter referred to as "RsXI") gene prepared by fully synthesizing the following gene while adjusting the codon usage frequency relative to the codon usage frequency in yeast: Japanese Patent Publication (Kokai ) No. 2011-147445A, the XI gene from the intestinal symbiotic protist of Reticulitermes speratus is known to show activity in Sacchar...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The promoter of the present invention causes a desired gene to be highly expressed, especially in thermotolerant yeast. The promoter is located upstream of the PIR1 gene or the CTR1 gene on the Kluyveromyces marxianus chromosome and comprises a region controlling expression of the PIR1 gene or the CTR1 gene.

Description

technical field [0001] The present invention relates to novel promoters that function in thermotolerant yeast and uses thereof. Background technique [0002] Yeast represented by Saccharomyces cerevisiae is widely used in the food industry by utilizing its fermentative ability and as a host for producing various substances. Furthermore, yeast is a major research subject in the field of genetic engineering. As an example of yeast, yeast whose optimum temperature range falls within a relatively high temperature range (also referred to as thermotolerant yeast) is well known, and Saccharomyces cerevisiae is also well known. [0003] Using such thermotolerant yeast, the reaction system can be maintained in a relatively high temperature range, making it possible to prevent contamination. In addition, yeast needs to be cultured in a relatively high temperature range, depending on the type of substance to be produced or the reaction system. In this case, it is particularly prefer...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12N15/81C12P7/06C12P1/02
CPCC12N15/815C12P7/10Y02E50/10C12N15/113C12N2320/50
Inventor志佐伦子赤田伦治星田尚司牟田口梢荣上村毅德弘健郎片平悟史
OwnerTOYOTA JIDOSHA KK