A radiation-resistant Fusarium fungus and its application in biological treatment of adsorbed cesium

A biological treatment, Fusarium technology, applied to radiation-resistant Fusarium and its application in radionuclide cesium adsorption, microbial strains are used in the field of bioabsorption of radionuclides, which can solve the limitation of the ability to repair radioactively polluted environments And other issues

Inactive Publication Date: 2017-04-19
THE INST OF MICROBIOLOGY XINJIANG ACADEMY OF AGRI SCI
View PDF1 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Since most bacteria are sensitive to radioactivity, their ability to remediate radioactively contaminated environments is limited
There are no reports on radioresistant Fusarium and its application in radionuclide adsorption

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • A radiation-resistant Fusarium fungus and its application in biological treatment of adsorbed cesium
  • A radiation-resistant Fusarium fungus and its application in biological treatment of adsorbed cesium
  • A radiation-resistant Fusarium fungus and its application in biological treatment of adsorbed cesium

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0036] Embodiment one: Fusarium ( Fusarium sp. .) Isolation and cultivation of F54 CGMCC No.8359

[0037] 1. Separation

[0038] Radiation resistant Fusarium used in the present invention ( Fusarium sp. .) The Institute of Microbiology Application of Xinjiang Academy of Agricultural Sciences took samples from radioactively contaminated soil in a certain place in Xinjiang, and used the traditional plate culture method to separate the microorganisms in the soil layer. The culture medium is an enrichment condition, and a batch of well-growing microbial strains are screened out, and a strain numbered F54 is selected out of them.

[0039] Separation steps: According to the gradient dilution method, weigh 10g of soil samples in 90mL sterile physiological saline, and perform gradient dilution after activation at 30°C for 30min. Select 10 -2 、10 -3 、10 -4 The dilutions were spread on the plates of PDA medium respectively, and each treatment was replicated three times, and cultu...

Embodiment 2

[0049] Embodiment two: Fusarium ( Fusarium sp. ) Molecular level identification of F54 CGMCC No.8359

[0050] 1. Extraction of fungal genome:

[0051] Pick fungal hyphae from the culture medium and remove agar as much as possible; add 200ul plant lysis buffer, grind to powder; add 600ul plant lysis buf, 0.8ul β-mercaptoethanol, mix well; 65℃ water bath for 40min, 12000rpm, 10min Centrifuge; remove the supernatant, add an equal volume of chloroform to extract, centrifuge at 12000rpm for 5min; add 700ul plant Bindingbuf, put on the column and let stand for 5min; Leave to evaporate and dry for 10 minutes, add 40ul H2O, let stand for 5-10 minutes; replace with a new tube, centrifuge at 13000rpm for 2 minutes, the genome is at the bottom of the tube.

[0052] 2. ITS sequence amplification and sequencing

[0053] Amplification with fungal ITS universal primers:

[0054] Forward primer ITS1: TCCGTAGGTGAACCTGCGG

[0055] Reverse primer ITS4: TCCTCCGCTTATTGATATGC

[0056] The PC...

Embodiment 3

[0059] Embodiment three: Fusarium ( Fusarium sp. .) Radiation resistance of F54 CGMCC No.8359

[0060] Two conditions must be met for microorganisms to treat radioactive pollution in the environment, that is, they can survive in a radiation environment and have high adsorption selectivity for polluting nuclides. The fungus Fusarium sp. ( Fusarium sp. ) F54 is extracted from radionuclide-contaminated soil. 60 Co radioactive source γ-ray irradiation, the cumulative radiation dose is 10 kGy. Through the comparison of irradiated samples and non-irradiated samples, it was found that its growth was not affected by irradiation, that is, Fusarium sp. F54 had a strong ability to resist radiation.

[0061] Show that Fusarium provided by the invention ( Fusarium sp. ) F54 CGMCC No.8359 was isolated from radioactive soil and accumulated with an irradiation dose of 10 kGy, which has strong radiation resistance.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a radiation-resistant Fusarium sp. and its application in the adsorption of radionuclide cesium. By providing a self-screening radiation-resistant Fusarium sp. (Fusarium sp.) F54 CGMCC No.8359 and its application, the test passed It is proved that the radiation-resistant Fusarium sp. F54 CGMCC No.8359 strain is tolerant to various metals, among which the tolerance concentration to Pb2+, Zn 2+ and Ni+ is the highest, which can reach 1000 mg / L respectively , 500 mg / L and 500 mg / L; the tolerance to Co2+, Cr2+, Hg2+ is next, all up to 200 mg / L. At the same time, the application of the strain in the adsorption of radionuclide cesium has achieved remarkable and obvious technical effects, which proves that the strain has a good application prospect in the biological treatment of cesium adsorption.

Description

technical field [0001] The invention relates to the technical field of a microbial strain applied to bioabsorption of radionuclides. Specifically, the invention relates to a radioresistant Fusarium fungus and the technical field of its application in radionuclide cesium adsorption. Background technique [0002] Urbanization, industrialization and population growth have caused a global energy crisis, and the need for sustainable development has made human beings more and more dependent on new energy. Nuclear energy has attracted more and more attention from many countries because of its extremely low carbon dioxide emission and huge development potential. The rapid development of nuclear energy has also brought enormous pressure to the global environment, making radioactive pollution one of the current major environmental problems, especially the nuclear accidents represented by Chernobyl and Fukushima nuclear power plants in Japan released a large amount of Radioactivity, c...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityPatents(China)
IPC IPC(8): C12N1/14G21F9/12C12R1/77
CPCC12N1/145C12R2001/77G21F9/12
Inventor张丽娟王玮张志东谢玉清韩小元赖成霞唐琦勇朱静楚敏
OwnerTHE INST OF MICROBIOLOGY XINJIANG ACADEMY OF AGRI SCI