Check patentability & draft patents in minutes with Patsnap Eureka AI!

Construction and application method of a high-yielding n-acetylglucosamine Escherichia coli

A technology of Escherichia coli and acetamido, applied in the field of genetic engineering, can solve a large number of problems and achieve the effect of enhancing gene expression

Inactive Publication Date: 2017-04-12
BINZHOU JINLANG BIOTECH
View PDF5 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

In the production process of glucosamine, a large amount of industrial wastewater containing hydrochloric acid (or sulfuric acid) acetic acid will be produced, which will bring great pressure to the environment

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Construction and application method of a high-yielding n-acetylglucosamine Escherichia coli

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0032] This embodiment is Escherichia coli as a host nagABE Knockout of gene clusters, the specific operation is as follows:

[0033] 1) According to the sequence of Escherichia coli BL21 (DE3) genome (Genbank No.CP001509) nagABE Gene cluster and its upstream and downstream sequences, designed primers: upstream primer nag-S1:

[0034] CTATCTGAGCTTGTCCGCCTGGTGTCATACTTTTCTCTAGTGTAGGCTGGAGCTGCTTC (shown in SEQ ID NO.1) and downstream primer nag-A1:

[0035] TGCGACGCTCAAGCGTCGCATCAGGCATAAAGCAGATTATGGGAATTAGCCATGGTCC (shown in SEQ ID NO. 2).

[0036] Using primers nag-S1 and nag-A1, and using plasmid pKD3 (GenBank: AY048742.1) as a template, the DNA fragment was amplified by conventional PCR and purified for future use.

[0037] 2) The above fragment was electrotransformed into Escherichia coli BL21 (DE3) competent cells containing the recombinant plasmid pKD46 and induced by adding arabinose, and the Red homologous recombination technology was used to knock out the nagABE g...

Embodiment 2

[0039] This embodiment is the Escherichia coli host manXYZ Knockout of gene clusters, the specific operation is as follows:

[0040] 1) According to the sequence of Escherichia coli BL21 (DE3) genome (Genbank No.CP001509) manXYZ Gene cluster and its upstream and downstream sequences, designed primers: upstream primer man-S1:

[0041] ACGTTGAGGTGTTAACGATAATAAAGGAGGTAGCAAGTGGTGTAGGCTGGAGCTGCTTC (shown in SEQ ID NO.3) and downstream primer man-A1:

[0042] AACGGGGCCAAAAGGCCCCGGTAGTGTACAACAGTCTTAATGGGAATTAGCCATGGTCC (shown in SEQ ID NO.4); using primers man-S1 and man-A1, using plasmid pKD4 (GenBank: AY048743.1) as a template, the DNA fragment was amplified by PCR and purified for later use.

[0043] 2) Electrotransform the above fragment into E. coli BL21(DE3) / ΔnagABE::Cm competent cells containing recombinant plasmid pKD46 and induced by adding arabinose, and use Red homologous recombination technology to knock out BL21(DE3) / ΔnagABE: : in Cm manXYZ Gene clusters, screened...

Embodiment 3

[0045] This example is to eliminate the resistance gene in the strain BL21(DE3) / ΔnagABE::Cm / ΔmanXYZ::Kan obtained in Example 2. The specific operation is as follows:

[0046] 1) Prepare BL21(DE3) / ΔnagABE::Cm / ΔmanXYZ::Kan competent cells, transform with pCP20 plasmid, and screen the correct transformants on the 30-degree ampicillin, kanamycin and chloramphenicol three-antibody plate.

[0047] 2) Streak the above transformants on an anti-antibody LB plate and culture at 42°C until a single colony appears.

[0048] 3) Pick a single colony and connect it to the LB plate without anti-antibody, and the double-antibody plate of kanamycin and chloramphenicol, and select the single colony that cannot grow on the double-antibody plate to eliminate kanamycin and chloramphenicol The antibiotic-resistant strain BL21(DE3) / ΔnagABE / ΔmanXYZ.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses construction and application methods of escherichia coli with a high yield of producing N-acetylglucosamine, and belongs to the technical field of genetic engineering. According to the construction and application methods disclosed by the invention, the decomposition and the intracellular transport pathways of N-acetylglucosamine and the by-products thereof are blocked by modifying and transforming the existing metabolic pathway of escherichia coli, meanwhile, an exogenous glucosamine acetylase gene is introduced, a complete synthesis pathway from glucose to N-acetylglucosamine is formed in a host, the constructed engineering strain is capable of utilizing glucose or glycerol as a substrate for synthesising N-acetylglucosamine through aerobic fermentation culture, so as to realize industrialized production.

Description

technical field [0001] The invention discloses a construction and application method of high-yield N-acetylglucosamine Escherichia coli, which belongs to the technical field of genetic engineering. Background technique [0002] N -Acetyl glucosamine is a derivative of glucose. It has various physiological functions in the human body. It is mainly used as the main component of cartilage and lubricating fluid in joints, and plays a very important role in the health of bones and joints. By supplementing exogenous glucosamine and N - Acetyl glucosamine has been widely used in the treatment of middle-aged and elderly joint diseases and joint pain relief as a common method in European and American countries. also, N - Acetyl glucosamine is also widely used in baby food additives, cosmetics and feed additives, and has a wide range of uses. [0003] Currently N - Acetyl glucosamine is produced through the chemical condensation reaction of glucosamine and acetic anhydride, and i...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12N15/70C12P19/26C12R1/19
Inventor 魏哲
Owner BINZHOU JINLANG BIOTECH
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More