Multiplex PCR detection primer and method for important viruses causing egg-laying abnormality
A detection method and multiple technologies, applied in the field of preventive veterinary medicine, can solve the problems of unreachable, slow recovery of laying eggs, etc., and achieve low-cost effects.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0026] Preparation of virus-specific capture probes
[0027]In the present invention, the specific capture probes used to detect 3 kinds of viruses that cause abnormal egg production in poultry are obtained by derivation as follows:
[0028] 1.1 According to the 100kd gene of Egg Drop Syndrome Virus (EDSV), the capsid protein gene of Avian Tembusu Virus (ATV) and the hemagglutinin protein gene of H9 Subtype Avian Influenza Virus (H9AIV) published in GenBank Conserved region sequence Conserved region and partial sequence of enhanced green fluorescent protein (EGFP), 3 pairs of primers were designed to prepare capture probes (see Table 1 below for primer information).
[0029]
[0030] 1.2. Using the green fluorescent protein particle (pIRES2-EGFP, Takara Biotechnology Co., Ltd., Dalian) as a template, use the above three pairs of primers to amplify. The PCR reaction system is 50 μL: 10 x FastPfu Buffer 5 μL, FastPfu DNA polymerase 1 μL (2.5 u / μL), dNTP (10 mM) 1 μL, 10 prim...
Embodiment 2
[0032] Establishment of Ligase-dependent PCR Detection Method
[0033] 2.1 According to the nucleic acid sequences of the three virus capture probes obtained, design a pair of reverse universal detection primers. The upstream primer is Seq ID No.4 (rEGFPF): 5'- CTCGGCGCGGGTCTTGTAGTT - 3', and the downstream primer is Seq ID No. .5 (rEGFPR): 5'- CTCGGCGCGGGTCTTGTAGTT - 3', use this pair of primers to amplify circularized probes targeting different viral nucleic acids to obtain nucleic acid fragments of different sizes.
[0034] 2.2 Collect duck livers or oviducts with abnormal egg production, homogenize according to conventional methods, dilute 1:3 with double-antibody-containing sterile PBS buffer (pH 7.2), divide into 2 parts, freeze and thaw repeatedly 3 times, and take One aliquot was centrifuged at 8 000 r·min-1 for 10 min, and the supernatant was taken to extract total DNA and RNA with DNR / RNA extraction kit (QIAGEN Company), respectively, according to the operation manua...
PUM

Abstract
Description
Claims
Application Information

- Generate Ideas
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com