Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Multiplex PCR detection primer and method for important viruses causing egg-laying abnormality

A detection method and multiple technologies, applied in the field of preventive veterinary medicine, can solve the problems of unreachable, slow recovery of laying eggs, etc., and achieve low-cost effects.

Active Publication Date: 2015-04-08
INST OF ANIMAL HUSBANDRY & VETERINARY FUJIAN ACADEMY OF AGRI SCI
View PDF2 Cites 6 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

The epidemiological survey of egg-laying poultry shows that more than 60% of abnormal egg production cases are caused by one or two of the three viruses, and clinically many clinical symptoms and lesions caused by these three pathogenic infections Very similar, often secondary or concurrent and easy to misdiagnose or delay treatment, resulting in more serious economic losses

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Multiplex PCR detection primer and method for important viruses causing egg-laying abnormality
  • Multiplex PCR detection primer and method for important viruses causing egg-laying abnormality

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0026] Preparation of virus-specific capture probes

[0027]In the present invention, the specific capture probes used to detect 3 kinds of viruses that cause abnormal egg production in poultry are obtained by derivation as follows:

[0028] 1.1 According to the 100kd gene of Egg Drop Syndrome Virus (EDSV), the capsid protein gene of Avian Tembusu Virus (ATV) and the hemagglutinin protein gene of H9 Subtype Avian Influenza Virus (H9AIV) published in GenBank Conserved region sequence Conserved region and partial sequence of enhanced green fluorescent protein (EGFP), 3 pairs of primers were designed to prepare capture probes (see Table 1 below for primer information).

[0029]

[0030] 1.2. Using the green fluorescent protein particle (pIRES2-EGFP, Takara Biotechnology Co., Ltd., Dalian) as a template, use the above three pairs of primers to amplify. The PCR reaction system is 50 μL: 10 x FastPfu Buffer 5 μL, FastPfu DNA polymerase 1 μL (2.5 u / μL), dNTP (10 mM) 1 μL, 10 prim...

Embodiment 2

[0032] Establishment of Ligase-dependent PCR Detection Method

[0033] 2.1 According to the nucleic acid sequences of the three virus capture probes obtained, design a pair of reverse universal detection primers. The upstream primer is Seq ID No.4 (rEGFPF): 5'- CTCGGCGCGGGTCTTGTAGTT - 3', and the downstream primer is Seq ID No. .5 (rEGFPR): 5'- CTCGGCGCGGGTCTTGTAGTT - 3', use this pair of primers to amplify circularized probes targeting different viral nucleic acids to obtain nucleic acid fragments of different sizes.

[0034] 2.2 Collect duck livers or oviducts with abnormal egg production, homogenize according to conventional methods, dilute 1:3 with double-antibody-containing sterile PBS buffer (pH 7.2), divide into 2 parts, freeze and thaw repeatedly 3 times, and take One aliquot was centrifuged at 8 000 r·min-1 for 10 min, and the supernatant was taken to extract total DNA and RNA with DNR / RNA extraction kit (QIAGEN Company), respectively, according to the operation manua...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a multiplex PCR detection primer and method for important viruses causing egg-laying abnormality. The method comprises the steps of preparing specificity capture probes aiming at viral nucleic acids of three important viruses such as an egg-laying descending syndrome virus, an avian Tembusu virus and an H9 subtype avian influenza virus which cause the egg-laying abnormality, carrying out hybridization on the specificity capture probes and the corresponding viral nucleic acids, then carrying out cyclization in the presence of ligase, carrying out PCR amplification by virtue of a pair of universal detection primers specific to the probes so as to detect, and determining infection pathogeny according to the size of an obtained amplified product. The method can be used for detecting a single virus and simultaneously differentially diagnosing three different viruses, has the characteristics of high efficiency, specificity and sensitivity and low cost, is applicable to the detection analysis of a large number of clinical samples when laying fowl cannot normally lay eggs, and is an important technological measure for the early rapid differential diagnosis and the molecular epidemiological analysis of pathogeny which definitely causes the egg-laying abnormality.

Description

technical field [0001] The invention relates to primers and a method for multiplex PCR detection of an important virus that causes abnormal egg production, in particular to a ligase-dependent multiple PCR identification and detection method for an important virus that causes abnormal egg production and its application, and belongs to the field of preventive veterinary medicine. Background technique [0002] In recent years, the problem of abnormal egg production caused by epidemic diseases in the breeding process of breeding poultry and layer poultry in my country has become more and more serious. The main manifestations are abnormal egg production and egg quality. Soft-shell eggs, sand-shell eggs, thin-shell eggs, deformed eggs and small eggs, etc., seriously affect the production performance of breeding (egg) poultry and cause huge economic losses. Existing studies have shown that many pathogens can lead to a decline in egg production in breeding (egg) poultry, such as avia...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12Q1/70C12Q1/68C12N15/11C12R1/93
CPCC12Q1/6862C12Q1/70C12Q2537/143C12Q2531/137
Inventor 傅光华傅秋玲黄瑜程龙飞施少华陈红梅万春和陈翠腾林建生
Owner INST OF ANIMAL HUSBANDRY & VETERINARY FUJIAN ACADEMY OF AGRI SCI
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com