Primers and methods for multiplex PCR detection of important viruses that cause abnormal egg production
A detection method and virus technology, applied in the field of preventive veterinary medicine, can solve the problems of unreachable, slow recovery of laying eggs of laying birds, etc., and achieve the effect of low cost
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0026] Preparation of virus-specific capture probes
[0027]In the present invention, the specific capture probes used to detect 3 kinds of viruses that cause abnormal egg production in poultry are obtained by derivation as follows:
[0028] 1.1 According to the 100kd gene of Egg Drop Syndrome Virus (EDSV), the capsid protein gene of Avian Tembusu Virus (ATV) and the hemagglutinin protein gene of H9 Subtype Avian Influenza Virus (H9AIV) published in GenBank Conserved region sequence Conserved region and partial sequence of enhanced green fluorescent protein (EGFP), 3 pairs of primers were designed to prepare capture probes (see Table 1 below for primer information).
[0029]
[0030] 1.2. Using the green fluorescent protein particle (pIRES2-EGFP, Takara Biotechnology Co., Ltd., Dalian) as a template, use the above three pairs of primers to amplify. The PCR reaction system is 50 μL: 10 x FastPfu Buffer 5 μL, FastPfu DNA polymerase 1 μL (2.5 u / μL), dNTP (10 mM) 1 μL, 10 prim...
Embodiment 2
[0032] Establishment of Ligase-dependent PCR Detection Method
[0033] 2.1 According to the nucleic acid sequences of the three virus capture probes obtained, design a pair of reverse universal detection primers. The upstream primer is Seq ID No.4 (rEGFPF): 5'- CTCGGCGCGGGTCTTGTAGTT - 3', and the downstream primer is Seq ID No. 5 (rEGFPR): 5'- CTCGGCGCGGGTCTTGTAGTT - 3', this pair of primers can be used to amplify circularized probes targeting different viral nucleic acids to obtain nucleic acid fragments of different sizes.
[0034] 2.2 Collect duck livers or oviducts with abnormal egg production, homogenize according to conventional methods, dilute 1:3 with double-antibody-containing sterile PBS buffer (pH 7.2), divide into 2 parts, freeze and thaw repeatedly 3 times, and take One aliquot was centrifuged at 8 000 r·min-1 for 10 min, and the supernatant was extracted with DNR / RNA extraction kit (QIAGEN) to extract total DNA and RNA, respectively, according to the operation ma...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 

